EMAIL THIS PAGE TO A FRIEND

TSGA10

testis specific, 10

Synonyms: CEP4L CT79
UniProtKB ID: Q9BZW7, D3DVH7, Q8NEP0, Q9BWX0
Gene ID:
Mouse(211484) testis specific 10
Rat(252923) testis specific 10
Zebrafish(768146) testis specific, 10
domestic cat(101096306) testis specific, 10
chicken(418696) testis specific, 10
dog(474561) testis specific, 10
cow(536433) testis specific, 10
sheep(101108208) testis specific, 10
domestic guinea pig(100716083) testis specific, 10
naked mole-rat(101725506) testis specific, 10
102 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_025244 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_025244 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_025244 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-XM_136734 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-XM_136734 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-XM_136734 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU083541 MISSION® esiRNA esiRNA human TSGA10 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_025244 Rosetta Predictions human pricing
NM_182911 Rosetta Predictions human pricing
XM_001057621 Rosetta Predictions rat pricing
XM_343557 Rosetta Predictions rat pricing
NM_207228 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025244 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00058442 predicted 2208
2 SASI_Hs02_00358069 predicted 1589
3 SASI_Hs01_00058444 predicted 2266
4 SASI_Hs01_00058445 predicted 1049
5 SASI_Hs02_00358070 predicted 1604
6 SASI_Hs01_00058446 predicted 1956
7 SASI_Hs01_00058447 predicted 1819
8 SASI_Hs02_00358071 predicted 740
9 SASI_Hs01_00058448 predicted 1195
10 SASI_Hs01_00058449 predicted 1008
11 SASI_Hs01_00058441 predicted 1760
12 SASI_Hs01_00058443 predicted 2072
13 SASI_Hs01_00058450 predicted 1790
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_182911 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00116946 predicted 2184
2 SASI_Hs02_00371019 predicted 1573
3 SASI_Hs01_00116948 predicted 2249
4 SASI_Hs01_00116949 predicted 1021
5 SASI_Hs02_00371020 predicted 1584
6 SASI_Hs01_00116950 predicted 1929
7 SASI_Hs01_00116951 predicted 1803
8 SASI_Hs02_00371021 predicted 721
9 SASI_Hs01_00116952 predicted 1177
10 SASI_Hs01_00116953 predicted 985
11 SASI_Hs01_00116945 predicted 1760
12 SASI_Hs01_00116947 predicted 2083
13 SASI_Hs01_00116954 predicted 1789
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001057621 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00286970 predicted 1287
2 SASI_Rn02_00286971 predicted 485
3 SASI_Rn02_00286972 predicted 1756
4 SASI_Rn02_00286973 predicted 2368
5 SASI_Rn02_00286974 predicted 454
6 SASI_Rn02_00286975 predicted 337
7 SASI_Rn02_00286976 predicted 656
8 SASI_Rn02_00286977 predicted 512
9 SASI_Rn02_00286978 predicted 537
10 SASI_Rn02_00286979 predicted 2208
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_343557 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00396018 predicted 1294
2 SASI_Rn02_00396019 predicted 495
3 SASI_Rn02_00396020 predicted 1762
4 SASI_Rn02_00396021 predicted 2381
5 SASI_Rn02_00396022 predicted 461
6 SASI_Rn02_00396023 predicted 348
7 SASI_Rn02_00396024 predicted 663
8 SASI_Rn02_00396025 predicted 516
9 SASI_Rn02_00396026 predicted 2217
10 SASI_Rn02_00396027 predicted 1027
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_207228 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00079294 predicted 1525
2 SASI_Mm01_00079295 predicted 1225
3 SASI_Mm01_00079296 predicted 2140
4 SASI_Mm01_00079297 predicted 1767
5 SASI_Mm01_00079298 predicted 1799
6 SASI_Mm01_00079299 predicted 2434
7 SASI_Mm01_00079300 predicted 2457
8 SASI_Mm01_00079301 predicted 1027
9 SASI_Mm02_00351945 predicted 674
10 SASI_Mm01_00079303 predicted 797
11 SASI_Mm01_00079302 predicted 1502
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025244
TSGA10 MISSION shRNA Bacterial Glycerol Stock
testis specific, 10
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000153642    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025244.1-974s1c1
Sequence:CCGGCCACAGAACGAGATAGTCTAACTCGAGTTAGACTATCTCGTTCTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000150340    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025244.1-1933s1c1
Sequence:CCGGGCAGATAACAATACCCTCAAACTCGAGTTTGAGGGTATTGTTATCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000150866    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025244.1-2698s1c1
Sequence:CCGGGAGAATCTTTGCTACAGAGATCTCGAGATCTCTGTAGCAAAGATTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000152670    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_025244.1-2884s1c1
Sequence:CCGGGCAGTGATCTGAGATGACTTACTCGAGTAAGTCATCTCAGATCACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000152224    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025244.1-2885s1c1
Sequence:CCGGCAGTGATCTGAGATGACTTATCTCGAGATAAGTCATCTCAGATCACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000151113    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025244.1-2344s1c1
Sequence:CCGGGCCAATCGAGACAAAGAATATCTCGAGATATTCTTTGTCTCGATTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000150901    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025244.1-881s1c1
Sequence:CCGGGCTGTAAGAGTCCTAAATCAACTCGAGTTGATTTAGGACTCTTACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000151555    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_025244.1-2852s1c1
Sequence:CCGGGTCTCTGAATCTCTGTTCTAACTCGAGTTAGAACAGAGATTCAGAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000157894    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025244.1-1485s1c1
Sequence:CCGGCCTTGGAGAGAGTTTGGCAATCTCGAGATTGCCAAACTCTCTCCAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000156661    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025244.1-1576s1c1
Sequence:CCGGGAGGCCCTAATTGTGTGTGAACTCGAGTTCACACACAATTAGGGCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025244
TSGA10 MISSION shRNA shRNA Plasmid DNA
testis specific, 10
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000153642    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025244.1-974s1c1
Sequence:CCGGCCACAGAACGAGATAGTCTAACTCGAGTTAGACTATCTCGTTCTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000150340    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025244.1-1933s1c1
Sequence:CCGGGCAGATAACAATACCCTCAAACTCGAGTTTGAGGGTATTGTTATCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000150866    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025244.1-2698s1c1
Sequence:CCGGGAGAATCTTTGCTACAGAGATCTCGAGATCTCTGTAGCAAAGATTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000152670    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_025244.1-2884s1c1
Sequence:CCGGGCAGTGATCTGAGATGACTTACTCGAGTAAGTCATCTCAGATCACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000152224    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025244.1-2885s1c1
Sequence:CCGGCAGTGATCTGAGATGACTTATCTCGAGATAAGTCATCTCAGATCACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000151113    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025244.1-2344s1c1
Sequence:CCGGGCCAATCGAGACAAAGAATATCTCGAGATATTCTTTGTCTCGATTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000150901    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025244.1-881s1c1
Sequence:CCGGGCTGTAAGAGTCCTAAATCAACTCGAGTTGATTTAGGACTCTTACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000151555    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_025244.1-2852s1c1
Sequence:CCGGGTCTCTGAATCTCTGTTCTAACTCGAGTTAGAACAGAGATTCAGAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000157894    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025244.1-1485s1c1
Sequence:CCGGCCTTGGAGAGAGTTTGGCAATCTCGAGATTGCCAAACTCTCTCCAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000156661    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025244.1-1576s1c1
Sequence:CCGGGAGGCCCTAATTGTGTGTGAACTCGAGTTCACACACAATTAGGGCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025244
TSGA10 MISSION shRNA Lentiviral Transduction Particles
testis specific, 10
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000153642    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025244.1-974s1c1
Sequence:CCGGCCACAGAACGAGATAGTCTAACTCGAGTTAGACTATCTCGTTCTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000150340    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025244.1-1933s1c1
Sequence:CCGGGCAGATAACAATACCCTCAAACTCGAGTTTGAGGGTATTGTTATCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000150866    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025244.1-2698s1c1
Sequence:CCGGGAGAATCTTTGCTACAGAGATCTCGAGATCTCTGTAGCAAAGATTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000152670    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_025244.1-2884s1c1
Sequence:CCGGGCAGTGATCTGAGATGACTTACTCGAGTAAGTCATCTCAGATCACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000152224    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025244.1-2885s1c1
Sequence:CCGGCAGTGATCTGAGATGACTTATCTCGAGATAAGTCATCTCAGATCACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000151113    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025244.1-2344s1c1
Sequence:CCGGGCCAATCGAGACAAAGAATATCTCGAGATATTCTTTGTCTCGATTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000150901    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025244.1-881s1c1
Sequence:CCGGGCTGTAAGAGTCCTAAATCAACTCGAGTTGATTTAGGACTCTTACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000151555    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_025244.1-2852s1c1
Sequence:CCGGGTCTCTGAATCTCTGTTCTAACTCGAGTTAGAACAGAGATTCAGAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000157894    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025244.1-1485s1c1
Sequence:CCGGCCTTGGAGAGAGTTTGGCAATCTCGAGATTGCCAAACTCTCTCCAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000156661    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025244.1-1576s1c1
Sequence:CCGGGAGGCCCTAATTGTGTGTGAACTCGAGTTCACACACAATTAGGGCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_136734
TSGA10 MISSION shRNA Bacterial Glycerol Stock
testis specific, 10
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000102006    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_136734.4-2197s1c1
Sequence:CCGGGCCAAAGATCAGGAAATAGAACTCGAGTTCTATTTCCTGATCTTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000102009    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_136734.4-662s1c1
Sequence:CCGGCAAACTGTGATGTAGAGCTTTCTCGAGAAAGCTCTACATCACAGTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000102005    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_136734.4-2025s1c1
Sequence:CCGGGCGCTCTTACAAATCCCAGATCTCGAGATCTGGGATTTGTAAGAGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000102008    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_136734.4-1558s1c1
Sequence:CCGGGCCCTCATTATGTGCGAACAACTCGAGTTGTTCGCACATAATGAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000102007    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_136734.4-2554s1c1
Sequence:CCGGCGCCAGAATTACTCAAGCAATCTCGAGATTGCTTGAGTAATTCTGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_136734
TSGA10 MISSION shRNA shRNA Plasmid DNA
testis specific, 10
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000102006    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_136734.4-2197s1c1
Sequence:CCGGGCCAAAGATCAGGAAATAGAACTCGAGTTCTATTTCCTGATCTTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000102009    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_136734.4-662s1c1
Sequence:CCGGCAAACTGTGATGTAGAGCTTTCTCGAGAAAGCTCTACATCACAGTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000102005    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_136734.4-2025s1c1
Sequence:CCGGGCGCTCTTACAAATCCCAGATCTCGAGATCTGGGATTTGTAAGAGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000102008    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_136734.4-1558s1c1
Sequence:CCGGGCCCTCATTATGTGCGAACAACTCGAGTTGTTCGCACATAATGAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000102007    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_136734.4-2554s1c1
Sequence:CCGGCGCCAGAATTACTCAAGCAATCTCGAGATTGCTTGAGTAATTCTGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_136734
TSGA10 MISSION shRNA Lentiviral Transduction Particles
testis specific, 10
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000102006    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_136734.4-2197s1c1
Sequence:CCGGGCCAAAGATCAGGAAATAGAACTCGAGTTCTATTTCCTGATCTTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000102009    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_136734.4-662s1c1
Sequence:CCGGCAAACTGTGATGTAGAGCTTTCTCGAGAAAGCTCTACATCACAGTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000102005    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_136734.4-2025s1c1
Sequence:CCGGGCGCTCTTACAAATCCCAGATCTCGAGATCTGGGATTTGTAAGAGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000102008    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_136734.4-1558s1c1
Sequence:CCGGGCCCTCATTATGTGCGAACAACTCGAGTTGTTCGCACATAATGAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000102007    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_136734.4-2554s1c1
Sequence:CCGGCGCCAGAATTACTCAAGCAATCTCGAGATTGCTTGAGTAATTCTGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks