EMAIL THIS PAGE TO A FRIEND

TSGA10IP

testis specific, 10 interacting protein

Synonyms: FAM161C
UniProtKB ID: Q3SY00, Q3SXZ9, Q3SY01, Q96M26
Gene ID:
Mouse(78306) testis specific 10 interacting protein
Rat(361707) testis specific 10 interacting protein
naked mole-rat(101714754) testis specific, 10 interacting protein
domestic guinea pig(100725190) testis specific, 10 interacting protein
cow(510521) testis specific, 10 interacting protein
sheep(101111918) testis specific, 10 interacting protein
dog(611966) testis specific, 10 interacting protein
domestic cat(101098087) testis specific, 10 interacting protein
65 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1301356 ANTI-TSGA10IP (C-TERM) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_152762 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_152762 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_152762 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_152762 Rosetta Predictions human pricing
NM_001004278 Rosetta Predictions rat pricing
XM_579136 Rosetta Predictions rat pricing
XM_981950 Rosetta Predictions mouse pricing
XR_031843 Rosetta Predictions mouse pricing
XR_034927 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_152762 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00165656 predicted 754
2 SASI_Hs01_00165657 predicted 936
3 SASI_Hs01_00165658 predicted 1071
4 SASI_Hs01_00165659 predicted 854
5 SASI_Hs01_00165660 predicted 1101
6 SASI_Hs01_00165661 predicted 1140
7 SASI_Hs01_00165662 predicted 935
8 SASI_Hs01_00165663 predicted 292
9 SASI_Hs01_00165664 predicted 461
10 SASI_Hs01_00165665 predicted 752
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001004278 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00114629 predicted 496
2 SASI_Rn01_00114630 predicted 1154
3 SASI_Rn01_00114631 predicted 1108
4 SASI_Rn01_00114632 predicted 975
5 SASI_Rn01_00114633 predicted 1544
6 SASI_Rn01_00114634 predicted 485
7 SASI_Rn01_00114635 predicted 1145
8 SASI_Rn01_00114636 predicted 866
9 SASI_Rn01_00114637 predicted 736
10 SASI_Rn01_00114638 predicted 985
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_579136 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00190822 predicted 501
2 SASI_Rn01_00190823 predicted 493
3 SASI_Rn01_00190824 predicted 297
4 SASI_Rn01_00190825 predicted 445
5 SASI_Rn01_00190826 predicted 219
6 SASI_Rn01_00190827 predicted 313
7 SASI_Rn01_00190828 predicted 503
8 SASI_Rn01_00190829 predicted 477
9 SASI_Rn01_00190830 predicted 471
10 SASI_Rn01_00190831 predicted 467
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_981950 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00212054 predicted 1502
2 SASI_Mm01_00212055 predicted 1384
3 SASI_Mm01_00212056 predicted 216
4 SASI_Mm01_00212057 predicted 264
5 SASI_Mm01_00212058 predicted 1353
6 SASI_Mm01_00212059 predicted 1386
7 SASI_Mm01_00212060 predicted 212
8 SASI_Mm01_00212061 predicted 1443
9 SASI_Mm01_00212062 predicted 1397
10 SASI_Mm01_00212063 predicted 1446
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_031843 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00461456 predicted 622
2 SASI_Mm02_00461457 predicted 1081
3 SASI_Mm02_00461458 predicted 569
4 SASI_Mm02_00461459 predicted 1082
5 SASI_Mm02_00461460 predicted 545
6 SASI_Mm02_00461461 predicted 625
7 SASI_Mm02_00461462 predicted 1068
8 SASI_Mm02_00461463 predicted 716
9 SASI_Mm02_00461464 predicted 1081
10 SASI_Mm02_00461465 predicted 583
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_034927 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00479177 predicted 625
2 SASI_Mm02_00479178 predicted 1083
3 SASI_Mm02_00479179 predicted 564
4 SASI_Mm02_00479180 predicted 1078
5 SASI_Mm02_00479181 predicted 549
6 SASI_Mm02_00479182 predicted 625
7 SASI_Mm02_00479183 predicted 1068
8 SASI_Mm02_00479184 predicted 711
9 SASI_Mm02_00479185 predicted 1077
10 SASI_Mm02_00479186 predicted 580
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_152762
TSGA10IP MISSION shRNA Bacterial Glycerol Stock
testis specific, 10 interacting protein
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000180863    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152762.1-312s1c1
Sequence:CCGGGAAGATCACTTCCCGCTTCTTCTCGAGAAGAAGCGGGAAGTGATCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000179037    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152762.1-1109s1c1
Sequence:CCGGCTCGGGATACGATGAAACTTTCTCGAGAAAGTTTCATCGTATCCCGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000180254    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152762.1-1146s1c1
Sequence:CCGGCCTAATCGCACCTTCCACAAACTCGAGTTTGTGGAAGGTGCGATTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000180233    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152762.1-239s1c1
Sequence:CCGGCTCAAGGCAGACAGCAAAGAACTCGAGTTCTTTGCTGTCTGCCTTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000439578    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152762.2-1087s21c1
Sequence:CCGGAGCGGAATGGAAAGGCCTATGCTCGAGCATAGGCCTTTCCATTCCGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000437970    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152762.2-834s21c1
Sequence:CCGGAGGGCTGGTTGTCAGAGAAAGCTCGAGCTTTCTCTGACAACCAGCCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000437956    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152762.2-931s21c1
Sequence:CCGGACAACCTCCGAAGGCGACAATCTCGAGATTGTCGCCTTCGGAGGTTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000421806    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152762.2-195s21c1
Sequence:CCGGGGTGATGGTGTGCCAAATCAACTCGAGTTGATTTGGCACACCATCACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000417624    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152762.2-759s21c1
Sequence:CCGGATCTCAGAGGAGGAGCAATTTCTCGAGAAATTGCTCCTCCTCTGAGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_152762
TSGA10IP MISSION shRNA shRNA Plasmid DNA
testis specific, 10 interacting protein
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000180863    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152762.1-312s1c1
Sequence:CCGGGAAGATCACTTCCCGCTTCTTCTCGAGAAGAAGCGGGAAGTGATCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000179037    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152762.1-1109s1c1
Sequence:CCGGCTCGGGATACGATGAAACTTTCTCGAGAAAGTTTCATCGTATCCCGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000180254    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152762.1-1146s1c1
Sequence:CCGGCCTAATCGCACCTTCCACAAACTCGAGTTTGTGGAAGGTGCGATTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000180233    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152762.1-239s1c1
Sequence:CCGGCTCAAGGCAGACAGCAAAGAACTCGAGTTCTTTGCTGTCTGCCTTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000439578    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152762.2-1087s21c1
Sequence:CCGGAGCGGAATGGAAAGGCCTATGCTCGAGCATAGGCCTTTCCATTCCGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000437970    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152762.2-834s21c1
Sequence:CCGGAGGGCTGGTTGTCAGAGAAAGCTCGAGCTTTCTCTGACAACCAGCCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000437956    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152762.2-931s21c1
Sequence:CCGGACAACCTCCGAAGGCGACAATCTCGAGATTGTCGCCTTCGGAGGTTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000421806    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152762.2-195s21c1
Sequence:CCGGGGTGATGGTGTGCCAAATCAACTCGAGTTGATTTGGCACACCATCACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000417624    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152762.2-759s21c1
Sequence:CCGGATCTCAGAGGAGGAGCAATTTCTCGAGAAATTGCTCCTCCTCTGAGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_152762
TSGA10IP MISSION shRNA Lentiviral Transduction Particles
testis specific, 10 interacting protein
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000180863    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152762.1-312s1c1
Sequence:CCGGGAAGATCACTTCCCGCTTCTTCTCGAGAAGAAGCGGGAAGTGATCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000179037    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152762.1-1109s1c1
Sequence:CCGGCTCGGGATACGATGAAACTTTCTCGAGAAAGTTTCATCGTATCCCGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000180254    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152762.1-1146s1c1
Sequence:CCGGCCTAATCGCACCTTCCACAAACTCGAGTTTGTGGAAGGTGCGATTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000180233    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152762.1-239s1c1
Sequence:CCGGCTCAAGGCAGACAGCAAAGAACTCGAGTTCTTTGCTGTCTGCCTTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000439578    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152762.2-1087s21c1
Sequence:CCGGAGCGGAATGGAAAGGCCTATGCTCGAGCATAGGCCTTTCCATTCCGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000437970    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152762.2-834s21c1
Sequence:CCGGAGGGCTGGTTGTCAGAGAAAGCTCGAGCTTTCTCTGACAACCAGCCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000437956    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152762.2-931s21c1
Sequence:CCGGACAACCTCCGAAGGCGACAATCTCGAGATTGTCGCCTTCGGAGGTTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000421806    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152762.2-195s21c1
Sequence:CCGGGGTGATGGTGTGCCAAATCAACTCGAGTTGATTTGGCACACCATCACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000417624    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152762.2-759s21c1
Sequence:CCGGATCTCAGAGGAGGAGCAATTTCTCGAGAAATTGCTCCTCCTCTGAGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks