EMAIL THIS PAGE TO A FRIEND

TSGA13

testis specific, 13

UniProtKB ID: Q96PP4, B3KSC9
Gene ID:
Mouse(116732) testis specific gene A13
Rat(688848) testis specific, 13
domestic cat(101093424) testis specific, 13
dog(608371) testis specific, 13
cow(616493) testis specific, 13
sheep(101118354) testis specific, 13
domestic guinea pig(100727433) testis specific, 13
naked mole-rat(101726199) testis specific, 13
85 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_054073 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_054073 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_054073 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_052933 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_052933 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_052933 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_052933 Rosetta Predictions human pricing
NM_001107851 Rosetta Predictions rat pricing
XM_001068562 Rosetta Predictions rat pricing
NM_054073 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_052933 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00150168 predicted 1331
2 SASI_Hs01_00150169 predicted 1262
3 SASI_Hs01_00150170 predicted 599
4 SASI_Hs01_00150171 predicted 1162
5 SASI_Hs01_00150172 predicted 525
6 SASI_Hs01_00150174 predicted 551
7 SASI_Hs02_00361712 predicted 664
8 SASI_Hs01_00150176 predicted 463
9 SASI_Hs01_00150177 predicted 589
10 SASI_Hs02_00361713 predicted 1133
11 SASI_Hs01_00150173 predicted 1139
12 SASI_Hs01_00150175 predicted 565
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107851 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00232905 predicted 472
2 SASI_Rn02_00232906 predicted 865
3 SASI_Rn02_00232907 predicted 844
4 SASI_Rn02_00232908 predicted 364
5 SASI_Rn02_00232909 predicted 579
6 SASI_Rn02_00232910 predicted 858
7 SASI_Rn02_00232911 predicted 691
8 SASI_Rn02_00232912 predicted 498
9 SASI_Rn02_00232913 predicted 379
10 SASI_Rn02_00232914 predicted 368
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001068562 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00324957 predicted 210
2 SASI_Rn02_00324958 predicted 309
3 SASI_Rn02_00324959 predicted 231
4 SASI_Rn02_00324960 predicted 253
5 SASI_Rn02_00324961 predicted 363
6 SASI_Rn02_00324962 predicted 287
7 SASI_Rn02_00324963 predicted 211
8 SASI_Rn02_00324964 predicted 335
9 SASI_Rn02_00324965 predicted 263
10 SASI_Rn02_00324966 predicted 322
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_054073 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00062475 predicted 275
2 SASI_Mm01_00062476 predicted 496
3 SASI_Mm01_00062477 predicted 694
4 SASI_Mm01_00062479 predicted 399
5 SASI_Mm01_00062480 predicted 323
6 SASI_Mm01_00062481 predicted 720
7 SASI_Mm01_00062482 predicted 394
8 SASI_Mm01_00062483 predicted 791
9 SASI_Mm01_00062484 predicted 880
10 SASI_Mm02_00338000 predicted 732
11 SASI_Mm01_00062478 predicted 300
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_054073
TSGA13 MISSION shRNA Bacterial Glycerol Stock
testis specific, 13
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000184042    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_054073.1-701s1c1
Sequence:CCGGCCCTATGAAACGGCTAGATGACTCGAGTCATCTAGCCGTTTCATAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000179400    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_054073.1-303s1c1
Sequence:CCGGGAGAAACAACTAGGTCAAGATCTCGAGATCTTGACCTAGTTGTTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000180022    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_054073.1-883s1c1
Sequence:CCGGCCATGAAGTCAGAGAGTGAAACTCGAGTTTCACTCTCTGACTTCATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000184805    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_054073.1-621s1c1
Sequence:CCGGCGGTGCAAACCCAACAAGAATCTCGAGATTCTTGTTGGGTTTGCACCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000184710    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_054073.1-590s1c1
Sequence:CCGGCCCGGAGTTTCAGTTAAAGGACTCGAGTCCTTTAACTGAAACTCCGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_054073
TSGA13 MISSION shRNA shRNA Plasmid DNA
testis specific, 13
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000184042    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_054073.1-701s1c1
Sequence:CCGGCCCTATGAAACGGCTAGATGACTCGAGTCATCTAGCCGTTTCATAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000179400    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_054073.1-303s1c1
Sequence:CCGGGAGAAACAACTAGGTCAAGATCTCGAGATCTTGACCTAGTTGTTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000180022    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_054073.1-883s1c1
Sequence:CCGGCCATGAAGTCAGAGAGTGAAACTCGAGTTTCACTCTCTGACTTCATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000184805    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_054073.1-621s1c1
Sequence:CCGGCGGTGCAAACCCAACAAGAATCTCGAGATTCTTGTTGGGTTTGCACCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000184710    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_054073.1-590s1c1
Sequence:CCGGCCCGGAGTTTCAGTTAAAGGACTCGAGTCCTTTAACTGAAACTCCGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_054073
TSGA13 MISSION shRNA Lentiviral Transduction Particles
testis specific, 13
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000184042    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_054073.1-701s1c1
Sequence:CCGGCCCTATGAAACGGCTAGATGACTCGAGTCATCTAGCCGTTTCATAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000179400    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_054073.1-303s1c1
Sequence:CCGGGAGAAACAACTAGGTCAAGATCTCGAGATCTTGACCTAGTTGTTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000180022    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_054073.1-883s1c1
Sequence:CCGGCCATGAAGTCAGAGAGTGAAACTCGAGTTTCACTCTCTGACTTCATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000184805    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_054073.1-621s1c1
Sequence:CCGGCGGTGCAAACCCAACAAGAATCTCGAGATTCTTGTTGGGTTTGCACCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000184710    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_054073.1-590s1c1
Sequence:CCGGCCCGGAGTTTCAGTTAAAGGACTCGAGTCCTTTAACTGAAACTCCGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_052933
TSGA13 MISSION shRNA Bacterial Glycerol Stock
testis specific, 13
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000138561    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052933.2-602s1c1
Sequence:CCGGCTTCGGCATTACACAGTCCATCTCGAGATGGACTGTGTAATGCCGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000135299    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_052933.2-741s1c1
Sequence:CCGGCGTTACTGATTATGACCAACACTCGAGTGTTGGTCATAATCAGTAACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000135919    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_052933.2-925s1c1
Sequence:CCGGGAAACCAATCTTCCCTTTGATCTCGAGATCAAAGGGAAGATTGGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000136412    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_052933.2-1091s1c1
Sequence:CCGGCATGAGAGAGATATGAGGAAACTCGAGTTTCCTCATATCTCTCTCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000136883    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052933.2-833s1c1
Sequence:CCGGCTCAAGGTCATGGAAAGTCATCTCGAGATGACTTTCCATGACCTTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000137061    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_052933.2-1090s1c1
Sequence:CCGGCCATGAGAGAGATATGAGGAACTCGAGTTCCTCATATCTCTCTCATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000137658    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052933.2-960s1c1
Sequence:CCGGCCACATCCAAGCGAGAACAATCTCGAGATTGTTCTCGCTTGGATGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000137423    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052933.2-922s1c1
Sequence:CCGGGCTGAAACCAATCTTCCCTTTCTCGAGAAAGGGAAGATTGGTTTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000137657    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_052933.2-1036s1c1
Sequence:CCGGCTACGCTTTGAGGACACAGAACTCGAGTTCTGTGTCCTCAAAGCGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000137117    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052933.2-730s1c1
Sequence:CCGGCCAGGATAAGACGTTACTGATCTCGAGATCAGTAACGTCTTATCCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_052933
TSGA13 MISSION shRNA shRNA Plasmid DNA
testis specific, 13
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000138561    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052933.2-602s1c1
Sequence:CCGGCTTCGGCATTACACAGTCCATCTCGAGATGGACTGTGTAATGCCGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000135299    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_052933.2-741s1c1
Sequence:CCGGCGTTACTGATTATGACCAACACTCGAGTGTTGGTCATAATCAGTAACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000135919    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_052933.2-925s1c1
Sequence:CCGGGAAACCAATCTTCCCTTTGATCTCGAGATCAAAGGGAAGATTGGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000136412    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_052933.2-1091s1c1
Sequence:CCGGCATGAGAGAGATATGAGGAAACTCGAGTTTCCTCATATCTCTCTCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000136883    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052933.2-833s1c1
Sequence:CCGGCTCAAGGTCATGGAAAGTCATCTCGAGATGACTTTCCATGACCTTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000137061    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_052933.2-1090s1c1
Sequence:CCGGCCATGAGAGAGATATGAGGAACTCGAGTTCCTCATATCTCTCTCATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000137658    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052933.2-960s1c1
Sequence:CCGGCCACATCCAAGCGAGAACAATCTCGAGATTGTTCTCGCTTGGATGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000137423    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052933.2-922s1c1
Sequence:CCGGGCTGAAACCAATCTTCCCTTTCTCGAGAAAGGGAAGATTGGTTTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000137657    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_052933.2-1036s1c1
Sequence:CCGGCTACGCTTTGAGGACACAGAACTCGAGTTCTGTGTCCTCAAAGCGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000137117    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052933.2-730s1c1
Sequence:CCGGCCAGGATAAGACGTTACTGATCTCGAGATCAGTAACGTCTTATCCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_052933
TSGA13 MISSION shRNA Lentiviral Transduction Particles
testis specific, 13
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000138561    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052933.2-602s1c1
Sequence:CCGGCTTCGGCATTACACAGTCCATCTCGAGATGGACTGTGTAATGCCGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000135299    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_052933.2-741s1c1
Sequence:CCGGCGTTACTGATTATGACCAACACTCGAGTGTTGGTCATAATCAGTAACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000135919    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_052933.2-925s1c1
Sequence:CCGGGAAACCAATCTTCCCTTTGATCTCGAGATCAAAGGGAAGATTGGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000136412    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_052933.2-1091s1c1
Sequence:CCGGCATGAGAGAGATATGAGGAAACTCGAGTTTCCTCATATCTCTCTCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000136883    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052933.2-833s1c1
Sequence:CCGGCTCAAGGTCATGGAAAGTCATCTCGAGATGACTTTCCATGACCTTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000137061    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_052933.2-1090s1c1
Sequence:CCGGCCATGAGAGAGATATGAGGAACTCGAGTTCCTCATATCTCTCTCATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000137658    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052933.2-960s1c1
Sequence:CCGGCCACATCCAAGCGAGAACAATCTCGAGATTGTTCTCGCTTGGATGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000137423    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052933.2-922s1c1
Sequence:CCGGGCTGAAACCAATCTTCCCTTTCTCGAGAAAGGGAAGATTGGTTTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000137657    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_052933.2-1036s1c1
Sequence:CCGGCTACGCTTTGAGGACACAGAACTCGAGTTCTGTGTCCTCAAAGCGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000137117    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052933.2-730s1c1
Sequence:CCGGCCAGGATAAGACGTTACTGATCTCGAGATCAGTAACGTCTTATCCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks