EMAIL THIS PAGE TO A FRIEND

TSHB

thyroid stimulating hormone, beta

Synonyms: TSH-B TSH-BETA
UniProtKB ID: P01222, B1AKP0, Q16163
Gene ID:
Human(7252) Summary: The four human glycoprotein hormones chorionic gonadotropin (CG), luteinizing hormone (LH), follicle stimulating hormone (FSH), and thyroid stimulating hormone (TSH) are dimers consisting of alpha and beta subunits that are associated noncovalently. The alpha subunits of these hormones are identical, however, their beta chains are unique and confer biological specificity. Thyroid stimulating hormone functions in the control of thyroid structure and metabolism. The protein encoded by this gene is the beta subunit of thyroid stimulating hormone. Mutations in this gene are associated with congenital central and secondary hypothyroidism and Hashimoto's thyroiditis. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, May 2013]
Mouse(22094) thyroid stimulating hormone, beta subunit
Rat(25653) thyroid stimulating hormone, beta
Zebrafish(353223) thyroid stimulating hormone, beta subunit
chicken(395937) thyroid stimulating hormone, beta
domestic cat(554350) thyroid stimulating hormone, beta
Horse(100034188) thyroid stimulating hormone, beta
dog(403973) thyroid stimulating hormone, beta
cow(281552) thyroid stimulating hormone, beta
sheep(101104284) thyroid stimulating hormone, beta
naked mole-rat(101720907) thyroid stimulating hormone, beta
Domestic Rabbit(100302414) thyroid stimulating hormone, beta
domestic guinea pig(100721947) thyroid stimulating hormone, beta
54 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1301017 ANTI-TSHB (CENTER) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
flow cytometry, immunofluorescence, immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_009432 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009432 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009432 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_000549 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000549 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000549 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU007231 MISSION® esiRNA esiRNA targeting human TSHB (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000549 Rosetta Predictions human pricing
NM_013116 Rosetta Predictions rat pricing
NM_009432 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000549 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00179380 predicted 216
2 SASI_Hs02_00302778 predicted 263
3 SASI_Hs01_00179381 predicted 209
4 SASI_Hs01_00179382 predicted 200
5 SASI_Hs02_00302779 predicted 267
6 SASI_Hs01_00179383 predicted 266
7 SASI_Hs01_00179384 predicted 220
8 SASI_Hs01_00179385 predicted 296
9 SASI_Hs01_00179386 predicted 196
10 SASI_Hs01_00179388 predicted 300
11 SASI_Hs01_00179387 predicted 291
12 SASI_Hs01_00179389 predicted 223
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013116 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00072286 predicted 227
2 SASI_Rn01_00072288 predicted 206
3 SASI_Rn01_00072289 predicted 332
4 SASI_Rn01_00072290 predicted 196
5 SASI_Rn01_00072291 predicted 322
6 SASI_Rn01_00072292 predicted 334
7 SASI_Rn01_00072293 predicted 266
8 SASI_Rn01_00072294 predicted 263
9 SASI_Rn01_00072295 predicted 195
10 SASI_Rn02_00260896 predicted 258
11 SASI_Rn01_00072287 predicted 243
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009432 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00316121 predicted 361
2 SASI_Mm02_00316122 predicted 329
3 SASI_Mm01_00120737 predicted 299
4 SASI_Mm01_00120739 predicted 309
5 SASI_Mm01_00120741 predicted 279
6 SASI_Mm01_00120746 predicted 349
7 SASI_Mm02_00316123 predicted 370
8 SASI_Mm02_00316124 predicted 365
9 SASI_Mm02_00316125 predicted 309
10 SASI_Mm02_00316126 predicted 373
11 SASI_Mm01_00120738 predicted 423
12 SASI_Mm01_00120740 predicted 267
13 SASI_Mm01_00120742 predicted 418
14 SASI_Mm01_00120743 predicted 223
15 SASI_Mm01_00120744 predicted 425
16 SASI_Mm01_00120745 predicted 241
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009432
TSHB MISSION shRNA Bacterial Glycerol Stock
thyroid stimulating hormone, beta
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000089368    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009432.1-419s1c1
Sequence:CCGGCGCACCATGTTACTCCTTATTCTCGAGAATAAGGAGTAACATGGTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000089371    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009432.1-416s1c1
Sequence:CCGGGCCCGCACCATGTTACTCCTTCTCGAGAAGGAGTAACATGGTGCGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000089372    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009432.1-232s1c1
Sequence:CCGGGAGTATACAATGTACGTGGATCTCGAGATCCACGTACATTGTATACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000089370    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009432.1-303s1c1
Sequence:CCGGGTATTGTATGACACGGGATATCTCGAGATATCCCGTGTCATACAATACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000089369    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009432.1-471s1c1
Sequence:CCGGTGGCAAGTGTAATACTGACAACTCGAGTTGTCAGTATTACACTTGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009432
TSHB MISSION shRNA shRNA Plasmid DNA
thyroid stimulating hormone, beta
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000089368    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009432.1-419s1c1
Sequence:CCGGCGCACCATGTTACTCCTTATTCTCGAGAATAAGGAGTAACATGGTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000089371    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009432.1-416s1c1
Sequence:CCGGGCCCGCACCATGTTACTCCTTCTCGAGAAGGAGTAACATGGTGCGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000089372    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009432.1-232s1c1
Sequence:CCGGGAGTATACAATGTACGTGGATCTCGAGATCCACGTACATTGTATACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000089370    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009432.1-303s1c1
Sequence:CCGGGTATTGTATGACACGGGATATCTCGAGATATCCCGTGTCATACAATACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000089369    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009432.1-471s1c1
Sequence:CCGGTGGCAAGTGTAATACTGACAACTCGAGTTGTCAGTATTACACTTGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009432
TSHB MISSION shRNA Lentiviral Transduction Particles
thyroid stimulating hormone, beta
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000089368    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009432.1-419s1c1
Sequence:CCGGCGCACCATGTTACTCCTTATTCTCGAGAATAAGGAGTAACATGGTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000089371    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009432.1-416s1c1
Sequence:CCGGGCCCGCACCATGTTACTCCTTCTCGAGAAGGAGTAACATGGTGCGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000089372    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009432.1-232s1c1
Sequence:CCGGGAGTATACAATGTACGTGGATCTCGAGATCCACGTACATTGTATACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000089370    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009432.1-303s1c1
Sequence:CCGGGTATTGTATGACACGGGATATCTCGAGATATCCCGTGTCATACAATACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000089369    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009432.1-471s1c1
Sequence:CCGGTGGCAAGTGTAATACTGACAACTCGAGTTGTCAGTATTACACTTGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000549
TSHB MISSION shRNA Bacterial Glycerol Stock
thyroid stimulating hormone, beta
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000078042    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000549.2-185s1c1
Sequence:CCGGCCTAACCATCAACACCACCATCTCGAGATGGTGGTGTTGATGGTTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000078039    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000549.2-385s1c1
Sequence:CCGGGCAAGTGCAATACTGACTATACTCGAGTATAGTCAGTATTGCACTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000078041    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000549.2-331s1c1
Sequence:CCGGCACTCCATGTTGCTCCCTATTCTCGAGAATAGGGAGCAACATGGAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000078040    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000549.2-199s1c1
Sequence:CCGGCCACCATCTGTGCTGGATATTCTCGAGAATATCCAGCACAGATGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000078038    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000549.2-271s1c1
Sequence:CCGGCCCAGGATGTTTGCACATATACTCGAGTATATGTGCAAACATCCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000434873    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000549.3-135s21c1
Sequence:CCGGATTCCAACTGAGTATACAATGCTCGAGCATTGTATACTCAGTTGGAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000429121    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000549.3-107s21c1
Sequence:CCGGTACATGTGGGCAAGCGATGTCCTCGAGGACATCGCTTGCCCACATGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000415044    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000549.3-308s21c1
Sequence:CCGGGACTGTAGAAATACCAGGATGCTCGAGCATCCTGGTATTTCTACAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000424080    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000549.3-232s21c1
Sequence:CCGGATATCAATGGCAAACTGTTTCCTCGAGGAAACAGTTTGCCATTGATATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000549
TSHB MISSION shRNA shRNA Plasmid DNA
thyroid stimulating hormone, beta
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000078042    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000549.2-185s1c1
Sequence:CCGGCCTAACCATCAACACCACCATCTCGAGATGGTGGTGTTGATGGTTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000078039    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000549.2-385s1c1
Sequence:CCGGGCAAGTGCAATACTGACTATACTCGAGTATAGTCAGTATTGCACTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000078041    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000549.2-331s1c1
Sequence:CCGGCACTCCATGTTGCTCCCTATTCTCGAGAATAGGGAGCAACATGGAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000078040    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000549.2-199s1c1
Sequence:CCGGCCACCATCTGTGCTGGATATTCTCGAGAATATCCAGCACAGATGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000078038    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000549.2-271s1c1
Sequence:CCGGCCCAGGATGTTTGCACATATACTCGAGTATATGTGCAAACATCCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000434873    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000549.3-135s21c1
Sequence:CCGGATTCCAACTGAGTATACAATGCTCGAGCATTGTATACTCAGTTGGAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000429121    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000549.3-107s21c1
Sequence:CCGGTACATGTGGGCAAGCGATGTCCTCGAGGACATCGCTTGCCCACATGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000415044    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000549.3-308s21c1
Sequence:CCGGGACTGTAGAAATACCAGGATGCTCGAGCATCCTGGTATTTCTACAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000424080    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000549.3-232s21c1
Sequence:CCGGATATCAATGGCAAACTGTTTCCTCGAGGAAACAGTTTGCCATTGATATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000549
TSHB MISSION shRNA Lentiviral Transduction Particles
thyroid stimulating hormone, beta
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000078042    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000549.2-185s1c1
Sequence:CCGGCCTAACCATCAACACCACCATCTCGAGATGGTGGTGTTGATGGTTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000078039    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000549.2-385s1c1
Sequence:CCGGGCAAGTGCAATACTGACTATACTCGAGTATAGTCAGTATTGCACTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000078041    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000549.2-331s1c1
Sequence:CCGGCACTCCATGTTGCTCCCTATTCTCGAGAATAGGGAGCAACATGGAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000078040    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000549.2-199s1c1
Sequence:CCGGCCACCATCTGTGCTGGATATTCTCGAGAATATCCAGCACAGATGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000078038    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000549.2-271s1c1
Sequence:CCGGCCCAGGATGTTTGCACATATACTCGAGTATATGTGCAAACATCCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000434873    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000549.3-135s21c1
Sequence:CCGGATTCCAACTGAGTATACAATGCTCGAGCATTGTATACTCAGTTGGAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000429121    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000549.3-107s21c1
Sequence:CCGGTACATGTGGGCAAGCGATGTCCTCGAGGACATCGCTTGCCCACATGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000415044    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000549.3-308s21c1
Sequence:CCGGGACTGTAGAAATACCAGGATGCTCGAGCATCCTGGTATTTCTACAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000424080    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000549.3-232s21c1
Sequence:CCGGATATCAATGGCAAACTGTTTCCTCGAGGAAACAGTTTGCCATTGATATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks