EMAIL THIS PAGE TO A FRIEND

TSHR

thyroid stimulating hormone receptor

Synonyms: CHNG1 LGR3 hTSHR-I
Gene ID:
Human(7253) Summary: The protein encoded by this gene is a membrane protein and a major controller of thyroid cell metabolism. The encoded protein is a receptor for thyrothropin and thyrostimulin, and its activity is mediated by adenylate cyclase. Defects in this gene are a cause of several types of hyperthyroidism. Three transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2008]
Mouse(22095) thyroid stimulating hormone receptor
Rat(25360) thyroid stimulating hormone receptor
Zebrafish(560609) thyroid stimulating hormone receptor
chicken(428900) thyroid stimulating hormone receptor
domestic cat(493842) thyroid stimulating hormone receptor
Horse(100052603) thyroid stimulating hormone receptor
dog(403968) thyroid stimulating hormone receptor
cow(281553) thyroid stimulating hormone receptor
sheep(443428) thyroid stimulating hormone receptor
domestic guinea pig(100721620) thyroid stimulating hormone receptor
naked mole-rat(101718949) thyroid stimulating hormone receptor
134 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
T5325 Anti-Thyrotropin (TSH) Receptor antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human
immunohistochemistry pricing
SAB2108555 Anti-TSHR affinity isolated antibody canine, rabbit, bovine, pig, sheep, bovine, mouse, guinea pig, human, horse
western blot pricing
AV41721 Anti-TSHR (AB1) antibody produced in rabbit affinity isolated antibody rat, horse, rabbit, bovine, human, canine, sheep, mouse, pig, guinea pig
western blot pricing
AV41871 Anti-TSHR (AB2) antibody produced in rabbit affinity isolated antibody canine, bovine, mouse, rabbit, human, guinea pig, horse, pig, sheep, rat
western blot pricing
SAB2501678 Anti-TSHR antibody produced in goat affinity isolated antibody, buffered aqueous solution human, bovine
ELISA, western blot pricing
SAB2108002 Anti-TSHR antibody produced in rabbit IgG fraction of antiserum human, mouse, bovine, rabbit, canine, rat, horse
western blot pricing
SAB2108246 Anti-TSHR antibody produced in rabbit affinity isolated antibody bovine, horse, rat, canine, mouse, guinea pig, human, pig, rabbit
western blot pricing
AV41870 Anti-TSHR antibody produced in rabbit IgG fraction of antiserum, lyophilized powder horse, canine, rat, human, mouse, bovine, rabbit
western blot pricing
HPA026680 Anti-TSHR antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry pricing
SAB2102588 Anti-TSHR antibody produced in rabbit affinity isolated antibody, lyophilized powder chicken, canine, bovine, human, horse, rabbit, mouse, rat, pig
western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_000369 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000369 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000369 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_011648 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011648 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011648 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000369 Rosetta Predictions human pricing
NM_001018036 Rosetta Predictions human pricing
NM_012888 Rosetta Predictions rat pricing
NM_001113404 Rosetta Predictions mouse pricing
NM_011648 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000369 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00034590 predicted 381
2 SASI_Hs01_00034591 predicted 583
3 SASI_Hs01_00034592 predicted 585
4 SASI_Hs01_00034593 predicted 467
5 SASI_Hs02_00302421 predicted 436
6 SASI_Hs01_00034594 predicted 527
7 SASI_Hs01_00034595 predicted 336
8 SASI_Hs01_00034596 predicted 474
9 SASI_Hs01_00034597 predicted 312
10 SASI_Hs01_00034598 predicted 264
11 SASI_Hs01_00034599 predicted 332
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001018036 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00120432 predicted 380
2 SASI_Hs01_00120433 predicted 584
3 SASI_Hs01_00120434 predicted 584
4 SASI_Hs01_00120435 predicted 468
5 SASI_Hs02_00306925 predicted 434
6 SASI_Hs01_00120436 predicted 527
7 SASI_Hs01_00120437 predicted 327
8 SASI_Hs01_00120438 predicted 472
9 SASI_Hs01_00120439 predicted 310
10 SASI_Hs01_00120440 predicted 260
11 SASI_Hs01_00120441 predicted 336
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012888 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00260403 predicted 1106
2 SASI_Rn01_00118314 predicted 2249
3 SASI_Rn01_00118315 predicted 987
4 SASI_Rn01_00118317 predicted 1878
5 SASI_Rn01_00118318 predicted 450
6 SASI_Rn01_00118321 predicted 1047
7 SASI_Rn01_00118322 predicted 277
8 SASI_Rn01_00118323 predicted 2312
9 SASI_Rn02_00260404 predicted 2048
10 SASI_Rn02_00260405 predicted 2437
11 SASI_Rn01_00118316 predicted 1300
12 SASI_Rn01_00118319 predicted 1098
13 SASI_Rn01_00118320 predicted 1374
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001113404 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00307746 predicted 497
2 SASI_Mm02_00307747 predicted 416
3 SASI_Mm02_00307748 predicted 536
4 SASI_Mm02_00307749 predicted 540
5 SASI_Mm02_00307750 predicted 210
6 SASI_Mm02_00307751 predicted 253
7 SASI_Mm02_00307752 predicted 488
8 SASI_Mm02_00307753 predicted 333
9 SASI_Mm02_00307754 predicted 469
10 SASI_Mm02_00307755 predicted 266
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011648 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00321122 predicted 500
2 SASI_Mm02_00321123 predicted 416
3 SASI_Mm02_00321124 predicted 531
4 SASI_Mm02_00321125 predicted 541
5 SASI_Mm02_00321126 predicted 208
6 SASI_Mm02_00321127 predicted 252
7 SASI_Mm01_00133285 predicted 489
8 SASI_Mm02_00321128 predicted 331
9 SASI_Mm02_00321129 predicted 465
10 SASI_Mm02_00321130 predicted 265
11 SASI_Mm01_00133282 predicted 1869
12 SASI_Mm01_00133283 predicted 1350
13 SASI_Mm01_00133284 predicted 1774
14 SASI_Mm01_00133286 predicted 999
15 SASI_Mm01_00133287 predicted 1976
16 SASI_Mm01_00133288 predicted 1986
17 SASI_Mm01_00133289 predicted 2174
18 SASI_Mm01_00133290 predicted 2422
19 SASI_Mm01_00133291 predicted 2228
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000369
TSHR MISSION shRNA Bacterial Glycerol Stock
thyroid stimulating hormone receptor
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000358221    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000369.2-1667s21c1
Sequence:CCGGCAAGCGAGTTATCGGTGTATACTCGAGTATACACCGATAACTCGCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000358149    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000369.2-2648s21c1
Sequence:CCGGGTTAGGCTACCAGCATATTTGCTCGAGCAAATATGCTGGTAGCCTAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000358152    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000369.2-1191s21c1
Sequence:CCGGTACTCATAACAACGCTCATTACTCGAGTAATGAGCGTTGTTATGAGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000358151    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000369.2-2145s21c1
Sequence:CCGGGGTACTCTTCTATCCACTTAACTCGAGTTAAGTGGATAGAAGAGTACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000014199    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000369.1-2234s1c1
Sequence:CCGGCCTCCAAAGAACAGCACTGATCTCGAGATCAGTGCTGTTCTTTGGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000014198    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000369.1-1147s1c1
Sequence:CCGGCGCTCATTATTACGTCTTCTTCTCGAGAAGAAGACGTAATAATGAGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000014202    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000369.1-710s1c1
Sequence:CCGGGCTGTTTACCTAAACAAGAATCTCGAGATTCTTGTTTAGGTAAACAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000014201    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000369.1-1610s1c1
Sequence:CCGGGCAAGCGAGTTATCGGTGTATCTCGAGATACACCGATAACTCGCTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000014200    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000369.1-325s1c1
Sequence:CCGGGCCCAATATTTCCAGAATCTACTCGAGTAGATTCTGGAAATATTGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000369
TSHR MISSION shRNA shRNA Plasmid DNA
thyroid stimulating hormone receptor
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000358221    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000369.2-1667s21c1
Sequence:CCGGCAAGCGAGTTATCGGTGTATACTCGAGTATACACCGATAACTCGCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000358149    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000369.2-2648s21c1
Sequence:CCGGGTTAGGCTACCAGCATATTTGCTCGAGCAAATATGCTGGTAGCCTAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000358152    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000369.2-1191s21c1
Sequence:CCGGTACTCATAACAACGCTCATTACTCGAGTAATGAGCGTTGTTATGAGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000358151    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000369.2-2145s21c1
Sequence:CCGGGGTACTCTTCTATCCACTTAACTCGAGTTAAGTGGATAGAAGAGTACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000014199    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000369.1-2234s1c1
Sequence:CCGGCCTCCAAAGAACAGCACTGATCTCGAGATCAGTGCTGTTCTTTGGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000014198    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000369.1-1147s1c1
Sequence:CCGGCGCTCATTATTACGTCTTCTTCTCGAGAAGAAGACGTAATAATGAGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000014202    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000369.1-710s1c1
Sequence:CCGGGCTGTTTACCTAAACAAGAATCTCGAGATTCTTGTTTAGGTAAACAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000014201    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000369.1-1610s1c1
Sequence:CCGGGCAAGCGAGTTATCGGTGTATCTCGAGATACACCGATAACTCGCTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000014200    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000369.1-325s1c1
Sequence:CCGGGCCCAATATTTCCAGAATCTACTCGAGTAGATTCTGGAAATATTGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000369
TSHR MISSION shRNA Lentiviral Transduction Particles
thyroid stimulating hormone receptor
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000358221    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000369.2-1667s21c1
Sequence:CCGGCAAGCGAGTTATCGGTGTATACTCGAGTATACACCGATAACTCGCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000358149    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000369.2-2648s21c1
Sequence:CCGGGTTAGGCTACCAGCATATTTGCTCGAGCAAATATGCTGGTAGCCTAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000358152    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000369.2-1191s21c1
Sequence:CCGGTACTCATAACAACGCTCATTACTCGAGTAATGAGCGTTGTTATGAGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000358151    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000369.2-2145s21c1
Sequence:CCGGGGTACTCTTCTATCCACTTAACTCGAGTTAAGTGGATAGAAGAGTACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000014199    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000369.1-2234s1c1
Sequence:CCGGCCTCCAAAGAACAGCACTGATCTCGAGATCAGTGCTGTTCTTTGGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000014198    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000369.1-1147s1c1
Sequence:CCGGCGCTCATTATTACGTCTTCTTCTCGAGAAGAAGACGTAATAATGAGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000014202    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000369.1-710s1c1
Sequence:CCGGGCTGTTTACCTAAACAAGAATCTCGAGATTCTTGTTTAGGTAAACAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000014201    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000369.1-1610s1c1
Sequence:CCGGGCAAGCGAGTTATCGGTGTATCTCGAGATACACCGATAACTCGCTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000014200    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000369.1-325s1c1
Sequence:CCGGGCCCAATATTTCCAGAATCTACTCGAGTAGATTCTGGAAATATTGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011648
TSHR MISSION shRNA Bacterial Glycerol Stock
thyroid stimulating hormone receptor
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000027838    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011648.2-976s1c1
Sequence:CCGGCCTGGAGTCTTTGATGTGTAACTCGAGTTACACATCAAAGACTCCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000027851    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011648.2-1129s1c1
Sequence:CCGGCCCAAGCAACTCTCACTATTACTCGAGTAATAGTGAGAGTTGCTTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000027811    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011648.2-2044s1c1
Sequence:CCGGGCCTCTAATCACTGTTACTAACTCGAGTTAGTAACAGTGATTAGAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000027795    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011648.2-2288s1c1
Sequence:CCGGCCCAACATGCAAGATACCTATCTCGAGATAGGTATCTTGCATGTTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000027779    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011648.2-265s1c1
Sequence:CCGGGCTCATCGAGACTCATCTGAACTCGAGTTCAGATGAGTCTCGATGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011648
TSHR MISSION shRNA shRNA Plasmid DNA
thyroid stimulating hormone receptor
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000027838    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011648.2-976s1c1
Sequence:CCGGCCTGGAGTCTTTGATGTGTAACTCGAGTTACACATCAAAGACTCCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000027851    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011648.2-1129s1c1
Sequence:CCGGCCCAAGCAACTCTCACTATTACTCGAGTAATAGTGAGAGTTGCTTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000027811    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011648.2-2044s1c1
Sequence:CCGGGCCTCTAATCACTGTTACTAACTCGAGTTAGTAACAGTGATTAGAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000027795    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011648.2-2288s1c1
Sequence:CCGGCCCAACATGCAAGATACCTATCTCGAGATAGGTATCTTGCATGTTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000027779    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011648.2-265s1c1
Sequence:CCGGGCTCATCGAGACTCATCTGAACTCGAGTTCAGATGAGTCTCGATGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011648
TSHR MISSION shRNA Lentiviral Transduction Particles
thyroid stimulating hormone receptor
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000027838    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011648.2-976s1c1
Sequence:CCGGCCTGGAGTCTTTGATGTGTAACTCGAGTTACACATCAAAGACTCCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000027851    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011648.2-1129s1c1
Sequence:CCGGCCCAAGCAACTCTCACTATTACTCGAGTAATAGTGAGAGTTGCTTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000027811    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011648.2-2044s1c1
Sequence:CCGGGCCTCTAATCACTGTTACTAACTCGAGTTAGTAACAGTGATTAGAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000027795    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011648.2-2288s1c1
Sequence:CCGGCCCAACATGCAAGATACCTATCTCGAGATAGGTATCTTGCATGTTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000027779    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011648.2-265s1c1
Sequence:CCGGGCTCATCGAGACTCATCTGAACTCGAGTTCAGATGAGTCTCGATGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks