EMAIL THIS PAGE TO A FRIEND

TSHZ1

teashirt zinc finger homeobox 1

Synonyms: CAA NY-CO-33 SDCCAG33 TSH1
UniProtKB ID: Q6ZSZ6, O60534, Q4LE29, Q53EU4
Gene ID:
Human(10194) Summary: This gene encodes a colon cancer antigen that was defined by serological analysis of recombinant cDNA expression libraries. The encoded protein is a member of the teashirt C2H2-type zinc-finger protein family and may be involved in transcriptional regulation of developmental processes. Mutations in this gene may be associated with congenital aural atresia syndrome. [provided by RefSeq, Jan 2012]
Mouse(110796) teashirt zinc finger family member 1
Rat(307217) teashirt zinc finger homeobox 1
Zebrafish(369196) teashirt family zinc finger 1
chicken(428513) teashirt zinc finger homeobox 1
Horse(100061993) teashirt zinc finger homeobox 1
domestic cat(101100005) teashirt zinc finger homeobox 1
dog(100684611) teashirt zinc finger homeobox 1
dog(476161) teashirt zinc finger homeobox 1
naked mole-rat(101706328) teashirt zinc finger homeobox 1
Domestic Rabbit(100346713) teashirt zinc finger homeobox 1
domestic guinea pig(101788391) teashirt zinc finger homeobox 1
cow(101905039) teashirt zinc finger homeobox 1
cow(516106) teashirt zinc finger homeobox 1
sheep(101110198) teashirt zinc finger homeobox 1
144 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_005786 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005786 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005786 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001081300 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001081300 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001081300 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005786 Rosetta Predictions human pricing
XM_001060440 Rosetta Predictions rat pricing
XM_225688 Rosetta Predictions rat pricing
NM_001081300 Rosetta Predictions mouse pricing
XM_888252 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005786 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00181932 predicted 3290
2 SASI_Hs01_00181933 predicted 3572
3 SASI_Hs01_00181934 predicted 2107
4 SASI_Hs01_00181935 predicted 3366
5 SASI_Hs02_00340280 predicted 3338
6 SASI_Hs01_00181937 predicted 3167
7 SASI_Hs01_00181938 predicted 3432
8 SASI_Hs01_00181939 predicted 3385
9 SASI_Hs01_00181940 predicted 3648
10 SASI_Hs01_00181941 predicted 2455
11 SASI_Hs01_00181936 predicted 2854
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001060440 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00296524 predicted 2463
2 SASI_Rn02_00296525 predicted 3195
3 SASI_Rn02_00296526 predicted 3143
4 SASI_Rn02_00296527 predicted 1501
5 SASI_Rn02_00296528 predicted 1440
6 SASI_Rn02_00296529 predicted 1465
7 SASI_Rn02_00296530 predicted 3013
8 SASI_Rn02_00296531 predicted 321
9 SASI_Rn02_00296532 predicted 383
10 SASI_Rn02_00296533 predicted 1431
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_225688 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00383034 predicted 2276
2 SASI_Rn02_00383035 predicted 2997
3 SASI_Rn02_00383036 predicted 2949
4 SASI_Rn02_00383037 predicted 224
5 SASI_Rn02_00383038 predicted 1308
6 SASI_Rn02_00383039 predicted 1243
7 SASI_Rn02_00383040 predicted 1265
8 SASI_Rn02_00383041 predicted 2155
9 SASI_Rn02_00383042 predicted 2823
10 SASI_Rn02_00383043 predicted 1236
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001081300 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00297101 predicted 4042
2 SASI_Mm02_00297102 predicted 2394
3 SASI_Mm02_00297103 predicted 1966
4 SASI_Mm02_00297104 predicted 3243
5 SASI_Mm02_00297105 predicted 4096
6 SASI_Mm02_00297106 predicted 3093
7 SASI_Mm02_00297107 predicted 2352
8 SASI_Mm02_00297108 predicted 1976
9 SASI_Mm02_00297109 predicted 3559
10 SASI_Mm02_00297110 predicted 2326
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_888252 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00237898 predicted 2981
2 SASI_Mm01_00237899 predicted 4045
3 SASI_Mm01_00237900 predicted 2404
4 SASI_Mm01_00237901 predicted 3243
5 SASI_Mm01_00237902 predicted 4102
6 SASI_Mm01_00237903 predicted 3099
7 SASI_Mm01_00237904 predicted 2356
8 SASI_Mm01_00237905 predicted 3564
9 SASI_Mm01_00237906 predicted 2333
10 SASI_Mm01_00237907 predicted 2367
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005786
VALIDATED
TSHZ1 MISSION shRNA Bacterial Glycerol Stock
teashirt zinc finger homeobox 1
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000019524    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005786.3-2874s1c1
Sequence:CCGGGCCATTAGCAAAGCTCAGAATCTCGAGATTCTGAGCTTTGCTAATGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000019527    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005786.3-3216s1c1
Sequence:CCGGGAGAATAAAGATTTCCCGAAACTCGAGTTTCGGGAAATCTTTATTCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000019528    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005786.3-1917s1c1
Sequence:CCGGGCCAGCAAGTTCCGGTGCAAACTCGAGTTTGCACCGGAACTTGCTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000019526    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A3
TRC Version: 1 Clone ID:NM_005786.3-4391s1c1
Sequence:CCGGCCTGATCTATGTGACTGAGTTCTCGAGAACTCAGTCACATAGATCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000019525    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005786.3-1579s1c1
Sequence:CCGGCCAGCTTAGCTCTGGATTTAACTCGAGTTAAATCCAGAGCTAAGCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000438521    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005786.4-3519s21c1
Sequence:CCGGGAAGACTTGGGCTCCACATTCCTCGAGGAATGTGGAGCCCAAGTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000422448    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005786.4-3205s21c1
Sequence:CCGGGGGTGCACATCTCGAAGTTTACTCGAGTAAACTTCGAGATGTGCACCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000413508    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005786.4-3545s21c1
Sequence:CCGGTAAGCTCTGCAACCGGACTTTCTCGAGAAAGTCCGGTTGCAGAGCTTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000414269    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005786.4-4001s21c1
Sequence:CCGGTGAAGTTGCCATGACAATAAACTCGAGTTTATTGTCATGGCAACTTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000435941    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005786.4-3928s21c1
Sequence:CCGGACACTACTCAGAGACATTATTCTCGAGAATAATGTCTCTGAGTAGTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000437173    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005786.4-2666s21c1
Sequence:CCGGGAGCGCTTTGCAGTCCATCATCTCGAGATGATGGACTGCAAAGCGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005786
VALIDATED
TSHZ1 MISSION shRNA shRNA Plasmid DNA
teashirt zinc finger homeobox 1
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000019524    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005786.3-2874s1c1
Sequence:CCGGGCCATTAGCAAAGCTCAGAATCTCGAGATTCTGAGCTTTGCTAATGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000019527    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005786.3-3216s1c1
Sequence:CCGGGAGAATAAAGATTTCCCGAAACTCGAGTTTCGGGAAATCTTTATTCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000019528    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005786.3-1917s1c1
Sequence:CCGGGCCAGCAAGTTCCGGTGCAAACTCGAGTTTGCACCGGAACTTGCTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000019526    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A3
TRC Version: 1 Clone ID:NM_005786.3-4391s1c1
Sequence:CCGGCCTGATCTATGTGACTGAGTTCTCGAGAACTCAGTCACATAGATCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000019525    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005786.3-1579s1c1
Sequence:CCGGCCAGCTTAGCTCTGGATTTAACTCGAGTTAAATCCAGAGCTAAGCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000438521    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005786.4-3519s21c1
Sequence:CCGGGAAGACTTGGGCTCCACATTCCTCGAGGAATGTGGAGCCCAAGTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000422448    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005786.4-3205s21c1
Sequence:CCGGGGGTGCACATCTCGAAGTTTACTCGAGTAAACTTCGAGATGTGCACCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000413508    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005786.4-3545s21c1
Sequence:CCGGTAAGCTCTGCAACCGGACTTTCTCGAGAAAGTCCGGTTGCAGAGCTTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000414269    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005786.4-4001s21c1
Sequence:CCGGTGAAGTTGCCATGACAATAAACTCGAGTTTATTGTCATGGCAACTTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000435941    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005786.4-3928s21c1
Sequence:CCGGACACTACTCAGAGACATTATTCTCGAGAATAATGTCTCTGAGTAGTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000437173    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005786.4-2666s21c1
Sequence:CCGGGAGCGCTTTGCAGTCCATCATCTCGAGATGATGGACTGCAAAGCGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005786
VALIDATED
TSHZ1 MISSION shRNA Lentiviral Transduction Particles
teashirt zinc finger homeobox 1
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000019524    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005786.3-2874s1c1
Sequence:CCGGGCCATTAGCAAAGCTCAGAATCTCGAGATTCTGAGCTTTGCTAATGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000019527    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005786.3-3216s1c1
Sequence:CCGGGAGAATAAAGATTTCCCGAAACTCGAGTTTCGGGAAATCTTTATTCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000019528    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005786.3-1917s1c1
Sequence:CCGGGCCAGCAAGTTCCGGTGCAAACTCGAGTTTGCACCGGAACTTGCTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000019526    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A3
TRC Version: 1 Clone ID:NM_005786.3-4391s1c1
Sequence:CCGGCCTGATCTATGTGACTGAGTTCTCGAGAACTCAGTCACATAGATCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000019525    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005786.3-1579s1c1
Sequence:CCGGCCAGCTTAGCTCTGGATTTAACTCGAGTTAAATCCAGAGCTAAGCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000438521    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005786.4-3519s21c1
Sequence:CCGGGAAGACTTGGGCTCCACATTCCTCGAGGAATGTGGAGCCCAAGTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000422448    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005786.4-3205s21c1
Sequence:CCGGGGGTGCACATCTCGAAGTTTACTCGAGTAAACTTCGAGATGTGCACCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000413508    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005786.4-3545s21c1
Sequence:CCGGTAAGCTCTGCAACCGGACTTTCTCGAGAAAGTCCGGTTGCAGAGCTTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000414269    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005786.4-4001s21c1
Sequence:CCGGTGAAGTTGCCATGACAATAAACTCGAGTTTATTGTCATGGCAACTTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000435941    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005786.4-3928s21c1
Sequence:CCGGACACTACTCAGAGACATTATTCTCGAGAATAATGTCTCTGAGTAGTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000437173    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005786.4-2666s21c1
Sequence:CCGGGAGCGCTTTGCAGTCCATCATCTCGAGATGATGGACTGCAAAGCGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001081300
TSHZ1 MISSION shRNA Bacterial Glycerol Stock
teashirt zinc finger homeobox 1
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000218777    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001081300.1-4751s21c1
Sequence:GTACCGGGCGATAAAGAGACATCCTAAACTCGAGTTTAGGATGTCTCTTTATCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000226057    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081300.1-1510s21c1
Sequence:CCGGAGCCGTGTATGCGAACTTATTCTCGAGAATAAGTTCGCATACACGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000226056    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081300.1-1217s21c1
Sequence:CCGGGAACTGAAGGCAGCCGAAATACTCGAGTATTTCGGCTGCCTTCAGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000226058    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081300.1-1548s21c1
Sequence:CCGGCTAGCCTAGCATTGGATTTAACTCGAGTTAAATCCAATGCTAGGCTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000251827    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081300.1-3567s21c1
Sequence:CCGGCAATCGACCGCTACTACTATGCTCGAGCATAGTAGTAGCGGTCGATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000376159    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081300.1-2351s21c1
Sequence:CCGGTACCAGAATGGTGCTAGTTACCTCGAGGTAACTAGCACCATTCTGGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000376213    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001081300.1-4703s21c1
Sequence:CCGGACGCTTCGGAGACATTGTTTACTCGAGTAAACAATGTCTCCGAAGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001081300
TSHZ1 MISSION shRNA shRNA Plasmid DNA
teashirt zinc finger homeobox 1
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000218777    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001081300.1-4751s21c1
Sequence:GTACCGGGCGATAAAGAGACATCCTAAACTCGAGTTTAGGATGTCTCTTTATCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000226057    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081300.1-1510s21c1
Sequence:CCGGAGCCGTGTATGCGAACTTATTCTCGAGAATAAGTTCGCATACACGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000226056    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081300.1-1217s21c1
Sequence:CCGGGAACTGAAGGCAGCCGAAATACTCGAGTATTTCGGCTGCCTTCAGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000226058    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081300.1-1548s21c1
Sequence:CCGGCTAGCCTAGCATTGGATTTAACTCGAGTTAAATCCAATGCTAGGCTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000251827    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081300.1-3567s21c1
Sequence:CCGGCAATCGACCGCTACTACTATGCTCGAGCATAGTAGTAGCGGTCGATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000376159    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081300.1-2351s21c1
Sequence:CCGGTACCAGAATGGTGCTAGTTACCTCGAGGTAACTAGCACCATTCTGGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000376213    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001081300.1-4703s21c1
Sequence:CCGGACGCTTCGGAGACATTGTTTACTCGAGTAAACAATGTCTCCGAAGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001081300
TSHZ1 MISSION shRNA Lentiviral Transduction Particles
teashirt zinc finger homeobox 1
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000218777    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001081300.1-4751s21c1
Sequence:GTACCGGGCGATAAAGAGACATCCTAAACTCGAGTTTAGGATGTCTCTTTATCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000226057    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081300.1-1510s21c1
Sequence:CCGGAGCCGTGTATGCGAACTTATTCTCGAGAATAAGTTCGCATACACGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000226056    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081300.1-1217s21c1
Sequence:CCGGGAACTGAAGGCAGCCGAAATACTCGAGTATTTCGGCTGCCTTCAGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000226058    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081300.1-1548s21c1
Sequence:CCGGCTAGCCTAGCATTGGATTTAACTCGAGTTAAATCCAATGCTAGGCTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000251827    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081300.1-3567s21c1
Sequence:CCGGCAATCGACCGCTACTACTATGCTCGAGCATAGTAGTAGCGGTCGATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000376159    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081300.1-2351s21c1
Sequence:CCGGTACCAGAATGGTGCTAGTTACCTCGAGGTAACTAGCACCATTCTGGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000376213    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001081300.1-4703s21c1
Sequence:CCGGACGCTTCGGAGACATTGTTTACTCGAGTAAACAATGTCTCCGAAGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks