EMAIL THIS PAGE TO A FRIEND

TSHZ2

teashirt zinc finger homeobox 2

Synonyms: C20orf17 OVC10-2 TSH2 ZABC2 ZNF218
UniProtKB ID: Q9NRE2, B7Z7W1, J3KNQ0, Q4VXM4, Q6N003, Q8N260
Gene ID:
Mouse(228911) teashirt zinc finger family member 2
Rat(100911757) teashirt zinc finger homeobox 2
cow(515677) teashirt zinc finger homeobox 2
sheep(101120263) teashirt zinc finger homeobox 2
domestic guinea pig(100722045) teashirt zinc finger homeobox 2
Zebrafish(100332862) teashirt zinc finger homeobox 2
Horse(100053109) teashirt zinc finger homeobox 2
domestic cat(101096641) teashirt zinc finger homeobox 2
chicken(419341) teashirt zinc finger homeobox 2
dog(485933) teashirt zinc finger homeobox 2
dog(100688380) teashirt zinc finger homeobox 2
42 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_173485 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_173485 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_173485 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_080455 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_080455 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_080455 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_173485 Rosetta Predictions human pricing
NM_080455 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_173485 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00072180 predicted 3626
2 SASI_Hs01_00072181 predicted 3125
3 SASI_Hs01_00072182 predicted 3768
4 SASI_Hs01_00072184 predicted 3779
5 SASI_Hs01_00072185 predicted 1335
6 SASI_Hs01_00072183 predicted 1519
7 SASI_Hs01_00072186 predicted 1553
8 SASI_Hs01_00072187 predicted 2287
9 SASI_Hs01_00072188 predicted 1709
10 SASI_Hs02_00368246 predicted 3658
11 SASI_Hs01_00072189 predicted 2900
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_080455 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00338110 predicted 2682
2 SASI_Mm02_00338111 predicted 2290
3 SASI_Mm02_00338112 predicted 1255
4 SASI_Mm02_00338113 predicted 2579
5 SASI_Mm02_00338114 predicted 876
6 SASI_Mm01_00074986 predicted 2783
7 SASI_Mm02_00338115 predicted 684
8 SASI_Mm01_00074988 predicted 2531
9 SASI_Mm02_00338116 predicted 554
10 SASI_Mm01_00074989 predicted 483
11 SASI_Mm01_00074985 predicted 451
12 SASI_Mm01_00074987 predicted 2840
13 SASI_Mm01_00074990 predicted 1592
14 SASI_Mm01_00074991 predicted 1845
15 SASI_Mm01_00074992 predicted 2227
16 SASI_Mm01_00074993 predicted 2816
17 SASI_Mm01_00074994 predicted 2656
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_173485
TSHZ2 MISSION shRNA Bacterial Glycerol Stock
teashirt zinc finger homeobox 2
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000421873    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_173485.4-4133s21c1
Sequence:CCGGACCATCCTGCTTCTGACATTGCTCGAGCAATGTCAGAAGCAGGATGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000416683    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173485.4-2646s21c1
Sequence:CCGGGTACTGCAGATCCGGCCTAATCTCGAGATTAGGCCGGATCTGCAGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000419443    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173485.4-3552s21c1
Sequence:CCGGCAGACATCAGAGGGCAAATACCTCGAGGTATTTGCCCTCTGATGTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000016663    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173485.2-3888s1c1
Sequence:CCGGCGGACATTTGTGAGCAAACATCTCGAGATGTTTGCTCACAAATGTCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000016666    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173485.2-1748s1c1
Sequence:CCGGCCAAGATTTGAGCGTCCACATCTCGAGATGTGGACGCTCAAATCTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000016667    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173485.2-3531s1c1
Sequence:CCGGCGTATGCAAATCTCTAAGTTTCTCGAGAAACTTAGAGATTTGCATACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000016664    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173485.2-1364s1c1
Sequence:CCGGCGGCAGCAACAAGAGTGATTTCTCGAGAAATCACTCTTGTTGCTGCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_173485
TSHZ2 MISSION shRNA shRNA Plasmid DNA
teashirt zinc finger homeobox 2
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000421873    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_173485.4-4133s21c1
Sequence:CCGGACCATCCTGCTTCTGACATTGCTCGAGCAATGTCAGAAGCAGGATGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000416683    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173485.4-2646s21c1
Sequence:CCGGGTACTGCAGATCCGGCCTAATCTCGAGATTAGGCCGGATCTGCAGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000419443    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173485.4-3552s21c1
Sequence:CCGGCAGACATCAGAGGGCAAATACCTCGAGGTATTTGCCCTCTGATGTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000016663    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173485.2-3888s1c1
Sequence:CCGGCGGACATTTGTGAGCAAACATCTCGAGATGTTTGCTCACAAATGTCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000016666    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173485.2-1748s1c1
Sequence:CCGGCCAAGATTTGAGCGTCCACATCTCGAGATGTGGACGCTCAAATCTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000016667    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173485.2-3531s1c1
Sequence:CCGGCGTATGCAAATCTCTAAGTTTCTCGAGAAACTTAGAGATTTGCATACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000016664    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173485.2-1364s1c1
Sequence:CCGGCGGCAGCAACAAGAGTGATTTCTCGAGAAATCACTCTTGTTGCTGCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_173485
TSHZ2 MISSION shRNA Lentiviral Transduction Particles
teashirt zinc finger homeobox 2
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000421873    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_173485.4-4133s21c1
Sequence:CCGGACCATCCTGCTTCTGACATTGCTCGAGCAATGTCAGAAGCAGGATGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000416683    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173485.4-2646s21c1
Sequence:CCGGGTACTGCAGATCCGGCCTAATCTCGAGATTAGGCCGGATCTGCAGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000419443    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173485.4-3552s21c1
Sequence:CCGGCAGACATCAGAGGGCAAATACCTCGAGGTATTTGCCCTCTGATGTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000016663    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173485.2-3888s1c1
Sequence:CCGGCGGACATTTGTGAGCAAACATCTCGAGATGTTTGCTCACAAATGTCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000016666    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173485.2-1748s1c1
Sequence:CCGGCCAAGATTTGAGCGTCCACATCTCGAGATGTGGACGCTCAAATCTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000016667    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173485.2-3531s1c1
Sequence:CCGGCGTATGCAAATCTCTAAGTTTCTCGAGAAACTTAGAGATTTGCATACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000016664    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173485.2-1364s1c1
Sequence:CCGGCGGCAGCAACAAGAGTGATTTCTCGAGAAATCACTCTTGTTGCTGCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_080455
TSHZ2 MISSION shRNA Bacterial Glycerol Stock
teashirt zinc finger homeobox 2
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000098070    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_080455.1-3674s1c1
Sequence:CCGGCCCGTGGGTTTATTTCACATACTCGAGTATGTGAAATAAACCCACGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000098073    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080455.1-367s1c1
Sequence:CCGGCCGAGATGTTTCAGACAAGAACTCGAGTTCTTGTCTGAAACATCTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000098074    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080455.1-2786s1c1
Sequence:CCGGCCAGAAACAATAGCTGGCGAACTCGAGTTCGCCAGCTATTGTTTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000098072    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080455.1-2843s1c1
Sequence:CCGGCGTCGGACATTTGTGAGCAAACTCGAGTTTGCTCACAAATGTCCGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000098071    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080455.1-1230s1c1
Sequence:CCGGCCACCGAGTTAAAGAAAGAAACTCGAGTTTCTTTCTTTAACTCGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_080455
TSHZ2 MISSION shRNA shRNA Plasmid DNA
teashirt zinc finger homeobox 2
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000098070    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_080455.1-3674s1c1
Sequence:CCGGCCCGTGGGTTTATTTCACATACTCGAGTATGTGAAATAAACCCACGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000098073    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080455.1-367s1c1
Sequence:CCGGCCGAGATGTTTCAGACAAGAACTCGAGTTCTTGTCTGAAACATCTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000098074    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080455.1-2786s1c1
Sequence:CCGGCCAGAAACAATAGCTGGCGAACTCGAGTTCGCCAGCTATTGTTTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000098072    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080455.1-2843s1c1
Sequence:CCGGCGTCGGACATTTGTGAGCAAACTCGAGTTTGCTCACAAATGTCCGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000098071    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080455.1-1230s1c1
Sequence:CCGGCCACCGAGTTAAAGAAAGAAACTCGAGTTTCTTTCTTTAACTCGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_080455
TSHZ2 MISSION shRNA Lentiviral Transduction Particles
teashirt zinc finger homeobox 2
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000098070    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_080455.1-3674s1c1
Sequence:CCGGCCCGTGGGTTTATTTCACATACTCGAGTATGTGAAATAAACCCACGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000098073    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080455.1-367s1c1
Sequence:CCGGCCGAGATGTTTCAGACAAGAACTCGAGTTCTTGTCTGAAACATCTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000098074    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080455.1-2786s1c1
Sequence:CCGGCCAGAAACAATAGCTGGCGAACTCGAGTTCGCCAGCTATTGTTTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000098072    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080455.1-2843s1c1
Sequence:CCGGCGTCGGACATTTGTGAGCAAACTCGAGTTTGCTCACAAATGTCCGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000098071    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080455.1-1230s1c1
Sequence:CCGGCCACCGAGTTAAAGAAAGAAACTCGAGTTTCTTTCTTTAACTCGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks