EMAIL THIS PAGE TO A FRIEND

TSHZ3

teashirt zinc finger homeobox 3

Synonyms: TSH3 ZNF537
UniProtKB ID: Q63HK5, Q9H0G6, Q9P254
Gene ID:
Mouse(243931) teashirt zinc finger family member 3
Rat(308523) teashirt zinc finger homeobox 3
chicken(415762) teashirt zinc finger homeobox 3
dog(484607) teashirt zinc finger homeobox 3
Horse(100054683) teashirt zinc finger homeobox 3
domestic cat(101085421) teashirt zinc finger homeobox 3
domestic guinea pig(100726735) teashirt zinc finger homeobox 3
naked mole-rat(101714435) teashirt zinc finger homeobox 3
cow(540209) teashirt zinc finger homeobox 3
sheep(101116250) teashirt zinc finger homeobox 3
169 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_172298 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_172298 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_172298 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_020856 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_020856 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_020856 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU118891 MISSION® esiRNA esiRNA human TSHZ3 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_020856 Rosetta Predictions human pricing
NM_001107506 Rosetta Predictions rat pricing
NM_172298 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020856 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00196266 predicted 1780
2 SASI_Hs01_00196267 predicted 2390
3 SASI_Hs01_00196268 predicted 3386
4 SASI_Hs01_00196269 predicted 1537
5 SASI_Hs01_00196270 predicted 920
6 SASI_Hs01_00196271 predicted 1567
7 SASI_Hs01_00196272 predicted 3220
8 SASI_Hs01_00196273 predicted 1114
9 SASI_Hs01_00196274 predicted 2535
10 SASI_Hs01_00196275 predicted 2591
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107506 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00229495 predicted 2470
2 SASI_Rn02_00229496 predicted 1140
3 SASI_Rn02_00229497 predicted 1713
4 SASI_Rn02_00229498 predicted 2333
5 SASI_Rn02_00229499 predicted 2381
6 SASI_Rn02_00229500 predicted 3159
7 SASI_Rn02_00229501 predicted 2836
8 SASI_Rn02_00229502 predicted 3240
9 SASI_Rn02_00229503 predicted 1497
10 SASI_Rn02_00229504 predicted 2522
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172298 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00157231 predicted 3282
2 SASI_Mm01_00157232 predicted 1985
3 SASI_Mm01_00157233 predicted 2887
4 SASI_Mm01_00157234 predicted 2466
5 SASI_Mm01_00157235 predicted 2515
6 SASI_Mm01_00157237 predicted 1352
7 SASI_Mm01_00157238 predicted 1276
8 SASI_Mm02_00343784 predicted 2984
9 SASI_Mm01_00157239 predicted 2655
10 SASI_Mm02_00343785 predicted 2605
11 SASI_Mm01_00157236 predicted 1702
12 SASI_Mm01_00157240 predicted 3383
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_172298
TSHZ3 MISSION shRNA Bacterial Glycerol Stock
teashirt zinc finger homeobox 3
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000081703    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172298.1-4090s1c1
Sequence:CCGGGCCTCTGTATAGTGTATATTTCTCGAGAAATATACACTATACAGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000081706    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172298.1-2618s1c1
Sequence:CCGGCCGTCGTATCCTTCATGTCAACTCGAGTTGACATGAAGGATACGACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000081707    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172298.1-202s1c1
Sequence:CCGGGCCTTGGTAGAAGATGACGTACTCGAGTACGTCATCTTCTACCAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000081704    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172298.1-2466s1c1
Sequence:CCGGCCGCTATTTCTACCACGTCAACTCGAGTTGACGTGGTAGAAATAGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000081705    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172298.1-1676s1c1
Sequence:CCGGGCCCTAAAGGTGGACTAGATACTCGAGTATCTAGTCCACCTTTAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000446791    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172298.2-993s21c1
Sequence:CCGGCCAAGACCTGAGCGTCCATATCTCGAGATATGGACGCTCAGGTCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000434301    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172298.2-1611s21c1
Sequence:CCGGAGAGGAGGAGAAGTATGATATCTCGAGATATCATACTTCTCCTCCTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000426249    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172298.2-1202s21c1
Sequence:CCGGACCCTTACATCACGCCAAATACTCGAGTATTTGGCGTGATGTAAGGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_172298
TSHZ3 MISSION shRNA shRNA Plasmid DNA
teashirt zinc finger homeobox 3
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000081703    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172298.1-4090s1c1
Sequence:CCGGGCCTCTGTATAGTGTATATTTCTCGAGAAATATACACTATACAGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000081706    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172298.1-2618s1c1
Sequence:CCGGCCGTCGTATCCTTCATGTCAACTCGAGTTGACATGAAGGATACGACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000081707    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172298.1-202s1c1
Sequence:CCGGGCCTTGGTAGAAGATGACGTACTCGAGTACGTCATCTTCTACCAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000081704    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172298.1-2466s1c1
Sequence:CCGGCCGCTATTTCTACCACGTCAACTCGAGTTGACGTGGTAGAAATAGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000081705    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172298.1-1676s1c1
Sequence:CCGGGCCCTAAAGGTGGACTAGATACTCGAGTATCTAGTCCACCTTTAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000446791    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172298.2-993s21c1
Sequence:CCGGCCAAGACCTGAGCGTCCATATCTCGAGATATGGACGCTCAGGTCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000434301    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172298.2-1611s21c1
Sequence:CCGGAGAGGAGGAGAAGTATGATATCTCGAGATATCATACTTCTCCTCCTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000426249    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172298.2-1202s21c1
Sequence:CCGGACCCTTACATCACGCCAAATACTCGAGTATTTGGCGTGATGTAAGGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_172298
TSHZ3 MISSION shRNA Lentiviral Transduction Particles
teashirt zinc finger homeobox 3
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000081703    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172298.1-4090s1c1
Sequence:CCGGGCCTCTGTATAGTGTATATTTCTCGAGAAATATACACTATACAGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000081706    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172298.1-2618s1c1
Sequence:CCGGCCGTCGTATCCTTCATGTCAACTCGAGTTGACATGAAGGATACGACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000081707    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172298.1-202s1c1
Sequence:CCGGGCCTTGGTAGAAGATGACGTACTCGAGTACGTCATCTTCTACCAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000081704    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172298.1-2466s1c1
Sequence:CCGGCCGCTATTTCTACCACGTCAACTCGAGTTGACGTGGTAGAAATAGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000081705    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172298.1-1676s1c1
Sequence:CCGGGCCCTAAAGGTGGACTAGATACTCGAGTATCTAGTCCACCTTTAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000446791    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172298.2-993s21c1
Sequence:CCGGCCAAGACCTGAGCGTCCATATCTCGAGATATGGACGCTCAGGTCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000434301    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172298.2-1611s21c1
Sequence:CCGGAGAGGAGGAGAAGTATGATATCTCGAGATATCATACTTCTCCTCCTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000426249    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172298.2-1202s21c1
Sequence:CCGGACCCTTACATCACGCCAAATACTCGAGTATTTGGCGTGATGTAAGGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020856
TSHZ3 MISSION shRNA Bacterial Glycerol Stock
teashirt zinc finger homeobox 3
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000015633    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020856.1-548s1c1
Sequence:CCGGCCCTTACATCACGCCAAATAACTCGAGTTATTTGGCGTGATGTAAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000015636    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020856.1-2410s1c1
Sequence:CCGGGTAACGATTGTGCGTCCCAAACTCGAGTTTGGGACGCACAATCGTTACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000015634    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020856.1-1838s1c1
Sequence:CCGGCCAGCCCATAGACTTGACAAACTCGAGTTTGTCAAGTCTATGGGCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000015635    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020856.1-1964s1c1
Sequence:CCGGCGTCGTATCATTCATGTCAAACTCGAGTTTGACATGAATGATACGACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000015637    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020856.1-200s1c1
Sequence:CCGGCGACAACCATGAGACCGATAACTCGAGTTATCGGTCTCATGGTTGTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000218826    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020856.2-4107s21c1
Sequence:GTACCGGAGATACCACAGATAGCATTTACTCGAGTAAATGCTATCTGTGGTATCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000230691    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020856.2-3215s21c1
Sequence:CCGGTGCCAGCAAGCACGCTGTTAACTCGAGTTAACAGCGTGCTTGCTGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000230690    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020856.2-2387s21c1
Sequence:CCGGAGACCACCTCGACCGCTATTTCTCGAGAAATAGCGGTCGAGGTGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000230689    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020856.2-1135s21c1
Sequence:CCGGACCCTTACATCACGCCAAATACTCGAGTATTTGGCGTGATGTAAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000230688    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020856.2-788s21c1
Sequence:CCGGCGACAACCATGAGACCGATAACTCGAGTTATCGGTCTCATGGTTGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020856
TSHZ3 MISSION shRNA shRNA Plasmid DNA
teashirt zinc finger homeobox 3
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000015633    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020856.1-548s1c1
Sequence:CCGGCCCTTACATCACGCCAAATAACTCGAGTTATTTGGCGTGATGTAAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000015636    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020856.1-2410s1c1
Sequence:CCGGGTAACGATTGTGCGTCCCAAACTCGAGTTTGGGACGCACAATCGTTACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000015634    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020856.1-1838s1c1
Sequence:CCGGCCAGCCCATAGACTTGACAAACTCGAGTTTGTCAAGTCTATGGGCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000015635    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020856.1-1964s1c1
Sequence:CCGGCGTCGTATCATTCATGTCAAACTCGAGTTTGACATGAATGATACGACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000015637    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020856.1-200s1c1
Sequence:CCGGCGACAACCATGAGACCGATAACTCGAGTTATCGGTCTCATGGTTGTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000218826    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020856.2-4107s21c1
Sequence:GTACCGGAGATACCACAGATAGCATTTACTCGAGTAAATGCTATCTGTGGTATCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000230691    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020856.2-3215s21c1
Sequence:CCGGTGCCAGCAAGCACGCTGTTAACTCGAGTTAACAGCGTGCTTGCTGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000230690    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020856.2-2387s21c1
Sequence:CCGGAGACCACCTCGACCGCTATTTCTCGAGAAATAGCGGTCGAGGTGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000230689    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020856.2-1135s21c1
Sequence:CCGGACCCTTACATCACGCCAAATACTCGAGTATTTGGCGTGATGTAAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000230688    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020856.2-788s21c1
Sequence:CCGGCGACAACCATGAGACCGATAACTCGAGTTATCGGTCTCATGGTTGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020856
TSHZ3 MISSION shRNA Lentiviral Transduction Particles
teashirt zinc finger homeobox 3
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000015633    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020856.1-548s1c1
Sequence:CCGGCCCTTACATCACGCCAAATAACTCGAGTTATTTGGCGTGATGTAAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000015636    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020856.1-2410s1c1
Sequence:CCGGGTAACGATTGTGCGTCCCAAACTCGAGTTTGGGACGCACAATCGTTACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000015634    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020856.1-1838s1c1
Sequence:CCGGCCAGCCCATAGACTTGACAAACTCGAGTTTGTCAAGTCTATGGGCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000015635    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020856.1-1964s1c1
Sequence:CCGGCGTCGTATCATTCATGTCAAACTCGAGTTTGACATGAATGATACGACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000015637    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020856.1-200s1c1
Sequence:CCGGCGACAACCATGAGACCGATAACTCGAGTTATCGGTCTCATGGTTGTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000218826    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020856.2-4107s21c1
Sequence:GTACCGGAGATACCACAGATAGCATTTACTCGAGTAAATGCTATCTGTGGTATCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000230691    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020856.2-3215s21c1
Sequence:CCGGTGCCAGCAAGCACGCTGTTAACTCGAGTTAACAGCGTGCTTGCTGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000230690    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020856.2-2387s21c1
Sequence:CCGGAGACCACCTCGACCGCTATTTCTCGAGAAATAGCGGTCGAGGTGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000230689    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020856.2-1135s21c1
Sequence:CCGGACCCTTACATCACGCCAAATACTCGAGTATTTGGCGTGATGTAAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000230688    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020856.2-788s21c1
Sequence:CCGGCGACAACCATGAGACCGATAACTCGAGTTATCGGTCTCATGGTTGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks