EMAIL THIS PAGE TO A FRIEND

TSKS

testis-specific serine kinase substrate

Synonyms: STK22S1 TSKS1 TSSKS
UniProtKB ID: Q9UJT2, Q8WXJ0
Gene ID:
Human(60385) Summary: This gene may play a role in testicular physiology, spermatogenesis or spermiogenesis. Expression of the encoded protein is highest in the testis and down-regulated in testicular cancer. The gene is localized to the region 19q13.3 among the related RAS viral oncogene homolog (RRAS) and interferon regulatory factor 3 (IRF3) genes, which are both involved in tumorigenesis pathways and progression. [provided by RefSeq, Jul 2008]
Mouse(22116) testis-specific serine kinase substrate
Rat(292890) testis-specific serine kinase substrate
cow(617757) testis-specific serine kinase substrate
sheep(101108334) testis-specific serine kinase substrate
naked mole-rat(101717972) testis-specific serine kinase substrate
domestic guinea pig(100723799) testis-specific serine kinase substrate
dog(611897) testis-specific serine kinase substrate
domestic cat(101094716) testis-specific serine kinase substrate
66 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_021733 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_021733 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_021733 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_011651 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011651 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011651 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_021733 Rosetta Predictions human pricing
NM_199088 Rosetta Predictions rat pricing
NM_001077591 Rosetta Predictions mouse pricing
NM_011651 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021733 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00035986 predicted 1470
2 SASI_Hs01_00035987 predicted 1255
3 SASI_Hs01_00035989 predicted 1275
4 SASI_Hs01_00035990 predicted 207
5 SASI_Hs02_00355059 predicted 1301
6 SASI_Hs01_00035991 predicted 226
7 SASI_Hs01_00035992 predicted 1514
8 SASI_Hs01_00035993 predicted 311
9 SASI_Hs01_00035994 predicted 443
10 SASI_Hs01_00035995 predicted 200
11 SASI_Hs01_00035988 predicted 304
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_199088 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00071076 predicted 308
2 SASI_Rn01_00071078 predicted 478
3 SASI_Rn01_00071079 predicted 635
4 SASI_Rn01_00071080 predicted 1296
5 SASI_Rn01_00071081 predicted 1165
6 SASI_Rn01_00071082 predicted 329
7 SASI_Rn01_00071083 predicted 250
8 SASI_Rn01_00071084 predicted 232
9 SASI_Rn01_00071085 predicted 1423
10 SASI_Rn02_00270095 predicted 448
11 SASI_Rn01_00071077 predicted 456
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001077591 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00292773 predicted 1194
2 SASI_Mm02_00292774 predicted 1062
3 SASI_Mm02_00292775 predicted 1162
4 SASI_Mm02_00292776 predicted 925
5 SASI_Mm02_00292777 predicted 933
6 SASI_Mm02_00292778 predicted 1292
7 SASI_Mm02_00292779 predicted 872
8 SASI_Mm02_00292780 predicted 1108
9 SASI_Mm02_00292781 predicted 1001
10 SASI_Mm02_00292782 predicted 1139
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011651 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00321133 predicted 1222
2 SASI_Mm02_00321134 predicted 1091
3 SASI_Mm01_00097900 predicted 1190
4 SASI_Mm02_00321135 predicted 951
5 SASI_Mm02_00321136 predicted 969
6 SASI_Mm01_00097903 predicted 1318
7 SASI_Mm02_00321137 predicted 895
8 SASI_Mm02_00321138 predicted 1136
9 SASI_Mm02_00321139 predicted 1029
10 SASI_Mm02_00321140 predicted 1168
11 SASI_Mm01_00097897 predicted 480
12 SASI_Mm01_00097898 predicted 656
13 SASI_Mm01_00097899 predicted 646
14 SASI_Mm01_00097901 predicted 516
15 SASI_Mm01_00097902 predicted 763
16 SASI_Mm01_00097904 predicted 453
17 SASI_Mm01_00097905 predicted 395
18 SASI_Mm01_00097906 predicted 1544
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_021733
TSKS MISSION shRNA Bacterial Glycerol Stock
testis-specific serine kinase substrate
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000418105    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021733.1-1290s21c1
Sequence:CCGGCAATTTCAGAACTCTCGAAGACTCGAGTCTTCGAGAGTTCTGAAATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000417683    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021733.1-570s21c1
Sequence:CCGGGGGTACTGCATTCAACTCAAGCTCGAGCTTGAGTTGAATGCAGTACCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000037653    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021733.1-41s1c1
Sequence:CCGGGCAGTCCAAAGAGATCCATGACTCGAGTCATGGATCTCTTTGGACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000037649    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021733.1-640s1c1
Sequence:CCGGCCAACGTCTTGAAGCAGAATTCTCGAGAATTCTGCTTCAAGACGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000037650    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021733.1-1262s1c1
Sequence:CCGGGAAACCCATTCTGGAGGAGTTCTCGAGAACTCCTCCAGAATGGGTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000037651    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021733.1-386s1c1
Sequence:CCGGTGACGCAGACATCACGGAAATCTCGAGATTTCCGTGATGTCTGCGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000037652    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021733.1-1485s1c1
Sequence:CCGGCAGAGGCTACACAAGAAGATTCTCGAGAATCTTCTTGTGTAGCCTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_021733
TSKS MISSION shRNA shRNA Plasmid DNA
testis-specific serine kinase substrate
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000418105    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021733.1-1290s21c1
Sequence:CCGGCAATTTCAGAACTCTCGAAGACTCGAGTCTTCGAGAGTTCTGAAATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000417683    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021733.1-570s21c1
Sequence:CCGGGGGTACTGCATTCAACTCAAGCTCGAGCTTGAGTTGAATGCAGTACCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000037653    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021733.1-41s1c1
Sequence:CCGGGCAGTCCAAAGAGATCCATGACTCGAGTCATGGATCTCTTTGGACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000037649    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021733.1-640s1c1
Sequence:CCGGCCAACGTCTTGAAGCAGAATTCTCGAGAATTCTGCTTCAAGACGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000037650    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021733.1-1262s1c1
Sequence:CCGGGAAACCCATTCTGGAGGAGTTCTCGAGAACTCCTCCAGAATGGGTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000037651    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021733.1-386s1c1
Sequence:CCGGTGACGCAGACATCACGGAAATCTCGAGATTTCCGTGATGTCTGCGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000037652    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021733.1-1485s1c1
Sequence:CCGGCAGAGGCTACACAAGAAGATTCTCGAGAATCTTCTTGTGTAGCCTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_021733
TSKS MISSION shRNA Lentiviral Transduction Particles
testis-specific serine kinase substrate
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000418105    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021733.1-1290s21c1
Sequence:CCGGCAATTTCAGAACTCTCGAAGACTCGAGTCTTCGAGAGTTCTGAAATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000417683    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021733.1-570s21c1
Sequence:CCGGGGGTACTGCATTCAACTCAAGCTCGAGCTTGAGTTGAATGCAGTACCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000037653    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021733.1-41s1c1
Sequence:CCGGGCAGTCCAAAGAGATCCATGACTCGAGTCATGGATCTCTTTGGACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000037649    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021733.1-640s1c1
Sequence:CCGGCCAACGTCTTGAAGCAGAATTCTCGAGAATTCTGCTTCAAGACGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000037650    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021733.1-1262s1c1
Sequence:CCGGGAAACCCATTCTGGAGGAGTTCTCGAGAACTCCTCCAGAATGGGTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000037651    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021733.1-386s1c1
Sequence:CCGGTGACGCAGACATCACGGAAATCTCGAGATTTCCGTGATGTCTGCGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000037652    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021733.1-1485s1c1
Sequence:CCGGCAGAGGCTACACAAGAAGATTCTCGAGAATCTTCTTGTGTAGCCTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011651
TSKS MISSION shRNA Bacterial Glycerol Stock
testis-specific serine kinase substrate
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000362743    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011651.2-1191s21c1
Sequence:CCGGGCAGATGAGTTGTGCACTATGCTCGAGCATAGTGCACAACTCATCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000362742    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011651.2-541s21c1
Sequence:CCGGGCTCTGTGCTGAGTGAGAATCCTCGAGGATTCTCACTCAGCACAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000362676    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011651.2-669s21c1
Sequence:CCGGTCAGTGGAAGACGCTGAAATCCTCGAGGATTTCAGCGTCTTCCACTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000362679    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011651.2-1652s21c1
Sequence:CCGGGGTGGCCACTTTGGACTATATCTCGAGATATAGTCCAAAGTGGCCACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000079088    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011651.1-1635s1c1
Sequence:CCGGGCCACTTTGGACTATATGCATCTCGAGATGCATATAGTCCAAAGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000079091    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011651.1-55s1c1
Sequence:CCGGCAATCCAAAGAGATCCACGAACTCGAGTTCGTGGATCTCTTTGGATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000079092    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011651.1-1170s1c1
Sequence:CCGGAGCAGATGAGTTGTGCACTATCTCGAGATAGTGCACAACTCATCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000079090    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011651.1-702s1c1
Sequence:CCGGGCTGGAGGAGAAGCTAAGATACTCGAGTATCTTAGCTTCTCCTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000079089    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011651.1-148s1c1
Sequence:CCGGCCTGCCAAAGGGATAACGAAACTCGAGTTTCGTTATCCCTTTGGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011651
TSKS MISSION shRNA shRNA Plasmid DNA
testis-specific serine kinase substrate
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000362743    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011651.2-1191s21c1
Sequence:CCGGGCAGATGAGTTGTGCACTATGCTCGAGCATAGTGCACAACTCATCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000362742    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011651.2-541s21c1
Sequence:CCGGGCTCTGTGCTGAGTGAGAATCCTCGAGGATTCTCACTCAGCACAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000362676    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011651.2-669s21c1
Sequence:CCGGTCAGTGGAAGACGCTGAAATCCTCGAGGATTTCAGCGTCTTCCACTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000362679    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011651.2-1652s21c1
Sequence:CCGGGGTGGCCACTTTGGACTATATCTCGAGATATAGTCCAAAGTGGCCACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000079088    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011651.1-1635s1c1
Sequence:CCGGGCCACTTTGGACTATATGCATCTCGAGATGCATATAGTCCAAAGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000079091    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011651.1-55s1c1
Sequence:CCGGCAATCCAAAGAGATCCACGAACTCGAGTTCGTGGATCTCTTTGGATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000079092    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011651.1-1170s1c1
Sequence:CCGGAGCAGATGAGTTGTGCACTATCTCGAGATAGTGCACAACTCATCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000079090    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011651.1-702s1c1
Sequence:CCGGGCTGGAGGAGAAGCTAAGATACTCGAGTATCTTAGCTTCTCCTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000079089    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011651.1-148s1c1
Sequence:CCGGCCTGCCAAAGGGATAACGAAACTCGAGTTTCGTTATCCCTTTGGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011651
TSKS MISSION shRNA Lentiviral Transduction Particles
testis-specific serine kinase substrate
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000362743    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011651.2-1191s21c1
Sequence:CCGGGCAGATGAGTTGTGCACTATGCTCGAGCATAGTGCACAACTCATCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000362742    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011651.2-541s21c1
Sequence:CCGGGCTCTGTGCTGAGTGAGAATCCTCGAGGATTCTCACTCAGCACAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000362676    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011651.2-669s21c1
Sequence:CCGGTCAGTGGAAGACGCTGAAATCCTCGAGGATTTCAGCGTCTTCCACTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000362679    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011651.2-1652s21c1
Sequence:CCGGGGTGGCCACTTTGGACTATATCTCGAGATATAGTCCAAAGTGGCCACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000079088    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011651.1-1635s1c1
Sequence:CCGGGCCACTTTGGACTATATGCATCTCGAGATGCATATAGTCCAAAGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000079091    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011651.1-55s1c1
Sequence:CCGGCAATCCAAAGAGATCCACGAACTCGAGTTCGTGGATCTCTTTGGATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000079092    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011651.1-1170s1c1
Sequence:CCGGAGCAGATGAGTTGTGCACTATCTCGAGATAGTGCACAACTCATCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000079090    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011651.1-702s1c1
Sequence:CCGGGCTGGAGGAGAAGCTAAGATACTCGAGTATCTTAGCTTCTCCTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000079089    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011651.1-148s1c1
Sequence:CCGGCCTGCCAAAGGGATAACGAAACTCGAGTTTCGTTATCCCTTTGGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks