EMAIL THIS PAGE TO A FRIEND

TSKU

tsukushi, small leucine rich proteoglycan

Synonyms: E2IG4 LRRC54 TSK
UniProtKB ID: Q8WUA8, B3KQT7, Q6UXK1, Q9UG10, Q9UJX9
Gene ID:
Mouse(244152) tsukushi
Rat(308843) tsukushi, small leucine rich proteoglycan
Zebrafish(325958) tsukushi small leucine rich proteoglycan homolog (Xenopus laevis)
chicken(419088) tsukushi small leucine rich proteoglycan homolog (Xenopus laevis)
domestic cat(101089390) tsukushi small leucine rich proteoglycan homolog (Xenopus laevis)
dog(485178) tsukushi small leucine rich proteoglycan homolog (Xenopus laevis)
domestic guinea pig(100716818) tsukushi, small leucine rich proteoglycan
naked mole-rat(101723198) tsukushi, small leucine rich proteoglycan
cow(529661) tsukushi small leucine rich proteoglycan homolog (Xenopus laevis)
sheep(101109738) tsukushi small leucine rich proteoglycan homolog (Xenopus laevis)
94 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001024619 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001024619 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001024619 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_015516 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_015516 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_015516 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_015516 Rosetta Predictions human pricing
NM_001009965 Rosetta Predictions rat pricing
XM_579321 Rosetta Predictions rat pricing
NM_001024619 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015516 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00210544 predicted 1335
2 SASI_Hs01_00210545 predicted 814
3 SASI_Hs01_00210546 predicted 1290
4 SASI_Hs02_00348011 predicted 1288
5 SASI_Hs01_00210547 predicted 1434
6 SASI_Hs01_00210548 predicted 1452
7 SASI_Hs01_00210549 predicted 451
8 SASI_Hs01_00210550 predicted 420
9 SASI_Hs01_00210551 predicted 642
10 SASI_Hs01_00210552 predicted 570
11 SASI_Hs01_00210543 predicted 1362
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001009965 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00079484 predicted 571
2 SASI_Rn01_00079485 predicted 1183
3 SASI_Rn02_00199799 predicted 1595
4 SASI_Rn01_00079486 predicted 1474
5 SASI_Rn01_00079487 predicted 1359
6 SASI_Rn01_00079489 predicted 543
7 SASI_Rn01_00079490 predicted 1359
8 SASI_Rn01_00079491 predicted 568
9 SASI_Rn01_00079492 predicted 631
10 SASI_Rn01_00079493 predicted 1301
11 SASI_Rn01_00079488 predicted 256
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_579321 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00144569 predicted 1055
2 SASI_Rn01_00144570 predicted 1113
3 SASI_Rn01_00144571 predicted 1400
4 SASI_Rn01_00144572 predicted 1284
5 SASI_Rn01_00144573 predicted 1348
6 SASI_Rn01_00144574 predicted 944
7 SASI_Rn01_00144575 predicted 1344
8 SASI_Rn01_00144576 predicted 1243
9 SASI_Rn01_00144577 predicted 1062
10 SASI_Rn01_00144578 predicted 1324
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001024619 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00287635 predicted 1225
2 SASI_Mm01_00195737 predicted 482
3 SASI_Mm01_00195739 predicted 453
4 SASI_Mm01_00195740 predicted 1512
5 SASI_Mm01_00195741 predicted 1542
6 SASI_Mm01_00195742 predicted 1212
7 SASI_Mm01_00195743 predicted 888
8 SASI_Mm01_00195744 predicted 1238
9 SASI_Mm01_00195745 predicted 541
10 SASI_Mm01_00195746 predicted 1574
11 SASI_Mm01_00195738 predicted 626
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001024619
TSKU MISSION shRNA Bacterial Glycerol Stock
tsukushi, small leucine rich proteoglycan
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000177879    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001024619.1-131s1c1
Sequence:CCGGCCAGTGTGAAGAAGAGACATTCTCGAGAATGTCTCTTCTTCACACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000177852    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001024619.1-1762s1c1
Sequence:CCGGCCATTCATTGTCTGTGCTGTTCTCGAGAACAGCACAGACAATGAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000198786    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001024619.1-962s1c1
Sequence:CCGGCCTCCCTGCTTTACAAAGTGTCTCGAGACACTTTGTAAAGCAGGGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000198400    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001024619.1-969s1c1
Sequence:CCGGGCTTTACAAAGTGTCAGCGTACTCGAGTACGCTGACACTTTGTAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000197985    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001024619.1-1231s1c1
Sequence:CCGGCGGCCATCTCAGTAAAGATATCTCGAGATATCTTTACTGAGATGGCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000281573    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001024619.2-544s21c1
Sequence:CCGGGGACCTATCCCACAATCTTATCTCGAGATAAGATTGTGGGATAGGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000262981    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001024619.2-1580s21c1
Sequence:CCGGGAATCCTGGGTAGAATCTTAACTCGAGTTAAGATTCTACCCAGGATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000262983    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001024619.2-484s21c1
Sequence:CCGGACTACGAGAGGTCTCGATATCCTCGAGGATATCGAGACCTCTCGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000262982    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001024619.2-461s21c1
Sequence:CCGGGACATCAATCTGAGCCATAACCTCGAGGTTATGGCTCAGATTGATGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000262980    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001024619.2-261s21c1
Sequence:CCGGACCGGCTAGAAACCGTGAATGCTCGAGCATTCACGGTTTCTAGCCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001024619
TSKU MISSION shRNA shRNA Plasmid DNA
tsukushi, small leucine rich proteoglycan
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000177879    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001024619.1-131s1c1
Sequence:CCGGCCAGTGTGAAGAAGAGACATTCTCGAGAATGTCTCTTCTTCACACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000177852    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001024619.1-1762s1c1
Sequence:CCGGCCATTCATTGTCTGTGCTGTTCTCGAGAACAGCACAGACAATGAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000198786    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001024619.1-962s1c1
Sequence:CCGGCCTCCCTGCTTTACAAAGTGTCTCGAGACACTTTGTAAAGCAGGGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000198400    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001024619.1-969s1c1
Sequence:CCGGGCTTTACAAAGTGTCAGCGTACTCGAGTACGCTGACACTTTGTAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000197985    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001024619.1-1231s1c1
Sequence:CCGGCGGCCATCTCAGTAAAGATATCTCGAGATATCTTTACTGAGATGGCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000281573    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001024619.2-544s21c1
Sequence:CCGGGGACCTATCCCACAATCTTATCTCGAGATAAGATTGTGGGATAGGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000262981    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001024619.2-1580s21c1
Sequence:CCGGGAATCCTGGGTAGAATCTTAACTCGAGTTAAGATTCTACCCAGGATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000262983    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001024619.2-484s21c1
Sequence:CCGGACTACGAGAGGTCTCGATATCCTCGAGGATATCGAGACCTCTCGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000262982    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001024619.2-461s21c1
Sequence:CCGGGACATCAATCTGAGCCATAACCTCGAGGTTATGGCTCAGATTGATGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000262980    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001024619.2-261s21c1
Sequence:CCGGACCGGCTAGAAACCGTGAATGCTCGAGCATTCACGGTTTCTAGCCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001024619
TSKU MISSION shRNA Lentiviral Transduction Particles
tsukushi, small leucine rich proteoglycan
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000177879    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001024619.1-131s1c1
Sequence:CCGGCCAGTGTGAAGAAGAGACATTCTCGAGAATGTCTCTTCTTCACACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000177852    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001024619.1-1762s1c1
Sequence:CCGGCCATTCATTGTCTGTGCTGTTCTCGAGAACAGCACAGACAATGAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000198786    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001024619.1-962s1c1
Sequence:CCGGCCTCCCTGCTTTACAAAGTGTCTCGAGACACTTTGTAAAGCAGGGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000198400    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001024619.1-969s1c1
Sequence:CCGGGCTTTACAAAGTGTCAGCGTACTCGAGTACGCTGACACTTTGTAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000197985    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001024619.1-1231s1c1
Sequence:CCGGCGGCCATCTCAGTAAAGATATCTCGAGATATCTTTACTGAGATGGCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000281573    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001024619.2-544s21c1
Sequence:CCGGGGACCTATCCCACAATCTTATCTCGAGATAAGATTGTGGGATAGGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000262981    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001024619.2-1580s21c1
Sequence:CCGGGAATCCTGGGTAGAATCTTAACTCGAGTTAAGATTCTACCCAGGATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000262983    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001024619.2-484s21c1
Sequence:CCGGACTACGAGAGGTCTCGATATCCTCGAGGATATCGAGACCTCTCGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000262982    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001024619.2-461s21c1
Sequence:CCGGGACATCAATCTGAGCCATAACCTCGAGGTTATGGCTCAGATTGATGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000262980    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001024619.2-261s21c1
Sequence:CCGGACCGGCTAGAAACCGTGAATGCTCGAGCATTCACGGTTTCTAGCCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015516
VALIDATED
TSKU MISSION shRNA Bacterial Glycerol Stock
tsukushi, small leucine rich proteoglycan
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000005220    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015516.1-1131s1c1
Sequence:CCGGCCCGAGTAACTTATGTTCAATCTCGAGATTGAACATAAGTTACTCGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000005223    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015516.1-123s1c1
Sequence:CCGGTCAGCCTGACTCGGGTGGATTCTCGAGAATCCACCCGAGTCAGGCTGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000005224    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015516.1-806s1c1
Sequence:CCGGCCCAAGCTTAACTGGGCAGGACTCGAGTCCTGCCCAGTTAAGCTTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000005222    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015516.1-415s1c1
Sequence:CCGGCGACGTGAACCTTAGCCACAACTCGAGTTGTGGCTAAGGTTCACGTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000005221    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015516.1-862s1c1
Sequence:CCGGGCTGGACCTTTCGGGCACCAACTCGAGTTGGTGCCCGAAAGGTCCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000350392    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_015516.3-574s21c1
Sequence:CCGGCGACGTGAACCTTAGCCACAACTCGAGTTGTGGCTAAGGTTCACGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000350393    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 2 Clone ID:NM_015516.3-1021s21c1
Sequence:CCGGGCTGGACCTTTCGGGCACCAACTCGAGTTGGTGCCCGAAAGGTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000314861    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 2 Clone ID:NM_015516.3-813s21c1
Sequence:CCGGGGAACCCTCTAGCTGTCATTGCTCGAGCAATGACAGCTAGAGGGTTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000314860    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015516.3-1220s21c1
Sequence:CCGGCCCACCATCTTGTGACAAATGCTCGAGCATTTGTCACAAGATGGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000314859    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 2 Clone ID:NM_015516.3-1290s21c1
Sequence:CCGGCCCGAGTAACTTATGTTCAATCTCGAGATTGAACATAAGTTACTCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015516
VALIDATED
TSKU MISSION shRNA shRNA Plasmid DNA
tsukushi, small leucine rich proteoglycan
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000005220    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015516.1-1131s1c1
Sequence:CCGGCCCGAGTAACTTATGTTCAATCTCGAGATTGAACATAAGTTACTCGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000005223    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015516.1-123s1c1
Sequence:CCGGTCAGCCTGACTCGGGTGGATTCTCGAGAATCCACCCGAGTCAGGCTGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000005224    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015516.1-806s1c1
Sequence:CCGGCCCAAGCTTAACTGGGCAGGACTCGAGTCCTGCCCAGTTAAGCTTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000005222    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015516.1-415s1c1
Sequence:CCGGCGACGTGAACCTTAGCCACAACTCGAGTTGTGGCTAAGGTTCACGTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000005221    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015516.1-862s1c1
Sequence:CCGGGCTGGACCTTTCGGGCACCAACTCGAGTTGGTGCCCGAAAGGTCCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000350392    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_015516.3-574s21c1
Sequence:CCGGCGACGTGAACCTTAGCCACAACTCGAGTTGTGGCTAAGGTTCACGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000350393    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 2 Clone ID:NM_015516.3-1021s21c1
Sequence:CCGGGCTGGACCTTTCGGGCACCAACTCGAGTTGGTGCCCGAAAGGTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000314861    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 2 Clone ID:NM_015516.3-813s21c1
Sequence:CCGGGGAACCCTCTAGCTGTCATTGCTCGAGCAATGACAGCTAGAGGGTTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000314860    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015516.3-1220s21c1
Sequence:CCGGCCCACCATCTTGTGACAAATGCTCGAGCATTTGTCACAAGATGGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000314859    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 2 Clone ID:NM_015516.3-1290s21c1
Sequence:CCGGCCCGAGTAACTTATGTTCAATCTCGAGATTGAACATAAGTTACTCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015516
VALIDATED
TSKU MISSION shRNA Lentiviral Transduction Particles
tsukushi, small leucine rich proteoglycan
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000005220    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015516.1-1131s1c1
Sequence:CCGGCCCGAGTAACTTATGTTCAATCTCGAGATTGAACATAAGTTACTCGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000005223    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015516.1-123s1c1
Sequence:CCGGTCAGCCTGACTCGGGTGGATTCTCGAGAATCCACCCGAGTCAGGCTGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000005224    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015516.1-806s1c1
Sequence:CCGGCCCAAGCTTAACTGGGCAGGACTCGAGTCCTGCCCAGTTAAGCTTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000005222    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015516.1-415s1c1
Sequence:CCGGCGACGTGAACCTTAGCCACAACTCGAGTTGTGGCTAAGGTTCACGTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000005221    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015516.1-862s1c1
Sequence:CCGGGCTGGACCTTTCGGGCACCAACTCGAGTTGGTGCCCGAAAGGTCCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000350392    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_015516.3-574s21c1
Sequence:CCGGCGACGTGAACCTTAGCCACAACTCGAGTTGTGGCTAAGGTTCACGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000350393    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 2 Clone ID:NM_015516.3-1021s21c1
Sequence:CCGGGCTGGACCTTTCGGGCACCAACTCGAGTTGGTGCCCGAAAGGTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000314861    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 2 Clone ID:NM_015516.3-813s21c1
Sequence:CCGGGGAACCCTCTAGCTGTCATTGCTCGAGCAATGACAGCTAGAGGGTTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000314860    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015516.3-1220s21c1
Sequence:CCGGCCCACCATCTTGTGACAAATGCTCGAGCATTTGTCACAAGATGGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000314859    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 2 Clone ID:NM_015516.3-1290s21c1
Sequence:CCGGCCCGAGTAACTTATGTTCAATCTCGAGATTGAACATAAGTTACTCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks