EMAIL THIS PAGE TO A FRIEND

TSLP

thymic stromal lymphopoietin

UniProtKB ID: Q969D9, Q8IW99
Gene ID:
Human(85480) Summary: This gene encodes a hemopoietic cytokine proposed to signal through a heterodimeric receptor complex composed of the thymic stromal lymphopoietin receptor and the IL-7R alpha chain. It mainly impacts myeloid cells and induces the release of T cell-attracting chemokines from monocytes and enhances the maturation of CD11c(+) dendritic cells. The protein promotes T helper type 2 (TH2) cell responses that are associated with immunity in various inflammatory diseases, including asthma, allergic inflammation and chronic obstructive pulmonary disease. The protein is therefore considered a potential therapeutic target for the treatment of such diseases. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Jan 2012]
Mouse(53603) thymic stromal lymphopoietin
Rat(688621) thymic stromal lymphopoietin
domestic cat(101085857) thymic stromal lymphopoietin
Horse(100302635) thymic stromal lymphopoietin
dog(607671) thymic stromal lymphopoietin
domestic guinea pig(101788673) thymic stromal lymphopoietin
163 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
PRS4021 Anti-TSLP (ab1) antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human
ELISA, immunohistochemistry, western blot pricing
PRS4023 Anti-TSLP (ab2) antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human, mouse
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
PRS4025 Anti-TSLP (ab3) antibody produced in rabbit affinity isolated antibody rat, mouse
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB2900398 Anti-TSLP antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human
immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_033035 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_033035 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_033035 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_021367 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_021367 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_021367 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU075571 MISSION® esiRNA esiRNA human TSLP (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_033035 Rosetta Predictions human pricing
NM_138551 Rosetta Predictions human pricing
XM_001067649 Rosetta Predictions rat pricing
NM_021367 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_033035 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00178545 predicted 653
2 SASI_Hs01_00178546 predicted 1011
3 SASI_Hs02_00360725 predicted 1165
4 SASI_Hs01_00178547 predicted 848
5 SASI_Hs01_00178548 predicted 906
6 SASI_Hs01_00178549 predicted 1053
7 SASI_Hs01_00178550 predicted 670
8 SASI_Hs01_00178551 predicted 906
9 SASI_Hs01_00178552 predicted 922
10 SASI_Hs01_00178553 predicted 628
11 SASI_Hs01_00178554 predicted 859
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_138551 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00137691 predicted 423
2 SASI_Hs01_00137692 predicted 778
3 SASI_Hs02_00363695 predicted 936
4 SASI_Hs01_00137693 predicted 616
5 SASI_Hs01_00137694 predicted 681
6 SASI_Hs01_00137695 predicted 819
7 SASI_Hs01_00137696 predicted 437
8 SASI_Hs01_00137697 predicted 672
9 SASI_Hs01_00137698 predicted 694
10 SASI_Hs01_00137699 predicted 395
11 SASI_Hs01_00137700 predicted 618
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001067649 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00321702 predicted 203
2 SASI_Rn02_00321703 predicted 213
3 SASI_Rn02_00321704 predicted 307
4 SASI_Rn02_00321705 predicted 221
5 SASI_Rn02_00321706 predicted 294
6 SASI_Rn02_00321707 predicted 265
7 SASI_Rn02_00321708 predicted 270
8 SASI_Rn02_00321709 predicted 214
9 SASI_Rn02_00321710 predicted 266
10 SASI_Rn02_00321711 predicted 286
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021367 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00144730 predicted 383
2 SASI_Mm01_00144731 predicted 413
3 SASI_Mm01_00144732 predicted 517
4 SASI_Mm01_00144733 predicted 387
5 SASI_Mm01_00144734 predicted 328
6 SASI_Mm01_00144735 predicted 406
7 SASI_Mm01_00144736 predicted 340
8 SASI_Mm02_00325956 predicted 315
9 SASI_Mm01_00144737 predicted 400
10 SASI_Mm01_00144738 predicted 491
11 SASI_Mm01_00144729 predicted 379
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_033035
VALIDATED
TSLP MISSION shRNA Bacterial Glycerol Stock
thymic stromal lymphopoietin
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000373909    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_033035.4-1011s21c1
Sequence:CCGGACTCAATGATAGCACCTAAACCTCGAGGTTTAGGTGCTATCATTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000373826    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.57 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_033035.4-681s21c1
Sequence:CCGGCCATCTTTATTATGGTCATATCTCGAGATATGACCATAATAAAGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000373825    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033035.4-403s21c1
Sequence:CCGGTTGTAGCAATCGGCCACATTGCTCGAGCAATGTGGCCGATTGCTACAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000029634    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033035.3-644s1c1
Sequence:CCGGCGTCGCTTCAATCGACCTTTACTCGAGTAAAGGTCGATTGAAGCGACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000029638    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_033035.3-534s1c1
Sequence:CCGGGCTATTCGGAAACTCAGATAACTCGAGTTATCTGAGTTTCCGAATAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000029637    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033035.3-320s1c1
Sequence:CCGGGCAGCCTATCTCAGTACTATTCTCGAGAATAGTACTGAGATAGGCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000029635    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033035.3-478s1c1
Sequence:CCGGCGCCAAAGAAATGTTCGCCATCTCGAGATGGCGAACATTTCTTTGGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000029636    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033035.3-286s1c1
Sequence:CCGGCGACTTCACTAACTGTGACTTCTCGAGAAGTCACAGTTAGTGAAGTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_033035
VALIDATED
TSLP MISSION shRNA shRNA Plasmid DNA
thymic stromal lymphopoietin
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000373909    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_033035.4-1011s21c1
Sequence:CCGGACTCAATGATAGCACCTAAACCTCGAGGTTTAGGTGCTATCATTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000373826    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.57 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_033035.4-681s21c1
Sequence:CCGGCCATCTTTATTATGGTCATATCTCGAGATATGACCATAATAAAGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000373825    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033035.4-403s21c1
Sequence:CCGGTTGTAGCAATCGGCCACATTGCTCGAGCAATGTGGCCGATTGCTACAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000029634    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033035.3-644s1c1
Sequence:CCGGCGTCGCTTCAATCGACCTTTACTCGAGTAAAGGTCGATTGAAGCGACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000029638    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_033035.3-534s1c1
Sequence:CCGGGCTATTCGGAAACTCAGATAACTCGAGTTATCTGAGTTTCCGAATAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000029637    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033035.3-320s1c1
Sequence:CCGGGCAGCCTATCTCAGTACTATTCTCGAGAATAGTACTGAGATAGGCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000029635    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033035.3-478s1c1
Sequence:CCGGCGCCAAAGAAATGTTCGCCATCTCGAGATGGCGAACATTTCTTTGGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000029636    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033035.3-286s1c1
Sequence:CCGGCGACTTCACTAACTGTGACTTCTCGAGAAGTCACAGTTAGTGAAGTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_033035
VALIDATED
TSLP MISSION shRNA Lentiviral Transduction Particles
thymic stromal lymphopoietin
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000373909    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_033035.4-1011s21c1
Sequence:CCGGACTCAATGATAGCACCTAAACCTCGAGGTTTAGGTGCTATCATTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000373826    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.57 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_033035.4-681s21c1
Sequence:CCGGCCATCTTTATTATGGTCATATCTCGAGATATGACCATAATAAAGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000373825    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033035.4-403s21c1
Sequence:CCGGTTGTAGCAATCGGCCACATTGCTCGAGCAATGTGGCCGATTGCTACAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000029634    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033035.3-644s1c1
Sequence:CCGGCGTCGCTTCAATCGACCTTTACTCGAGTAAAGGTCGATTGAAGCGACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000029638    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_033035.3-534s1c1
Sequence:CCGGGCTATTCGGAAACTCAGATAACTCGAGTTATCTGAGTTTCCGAATAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000029637    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033035.3-320s1c1
Sequence:CCGGGCAGCCTATCTCAGTACTATTCTCGAGAATAGTACTGAGATAGGCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000029635    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033035.3-478s1c1
Sequence:CCGGCGCCAAAGAAATGTTCGCCATCTCGAGATGGCGAACATTTCTTTGGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000029636    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033035.3-286s1c1
Sequence:CCGGCGACTTCACTAACTGTGACTTCTCGAGAAGTCACAGTTAGTGAAGTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_021367
TSLP MISSION shRNA Bacterial Glycerol Stock
thymic stromal lymphopoietin
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000076993    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021367.1-521s1c1
Sequence:CCGGCCACTGGTGTTTATTCTTTAACTCGAGTTAAAGAATAAACACCAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000076996    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021367.1-380s1c1
Sequence:CCGGTCTGAATCAAACCTCACAAATCTCGAGATTTGTGAGGTTTGATTCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000076997    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021367.1-391s1c1
Sequence:CCGGCCTCACAAATTCTAAGATTGTCTCGAGACAATCTTAGAATTTGTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000076995    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021367.1-316s1c1
Sequence:CCGGGCTACCCTGAAACTGAGAGAACTCGAGTTCTCTCAGTTTCAGGGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000076994    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021367.1-418s1c1
Sequence:CCGGCCTTCATGCAATCTCCAGAATCTCGAGATTCTGGAGATTGCATGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_021367
TSLP MISSION shRNA shRNA Plasmid DNA
thymic stromal lymphopoietin
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000076993    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021367.1-521s1c1
Sequence:CCGGCCACTGGTGTTTATTCTTTAACTCGAGTTAAAGAATAAACACCAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000076996    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021367.1-380s1c1
Sequence:CCGGTCTGAATCAAACCTCACAAATCTCGAGATTTGTGAGGTTTGATTCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000076997    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021367.1-391s1c1
Sequence:CCGGCCTCACAAATTCTAAGATTGTCTCGAGACAATCTTAGAATTTGTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000076995    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021367.1-316s1c1
Sequence:CCGGGCTACCCTGAAACTGAGAGAACTCGAGTTCTCTCAGTTTCAGGGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000076994    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021367.1-418s1c1
Sequence:CCGGCCTTCATGCAATCTCCAGAATCTCGAGATTCTGGAGATTGCATGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_021367
TSLP MISSION shRNA Lentiviral Transduction Particles
thymic stromal lymphopoietin
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000076993    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021367.1-521s1c1
Sequence:CCGGCCACTGGTGTTTATTCTTTAACTCGAGTTAAAGAATAAACACCAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000076996    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021367.1-380s1c1
Sequence:CCGGTCTGAATCAAACCTCACAAATCTCGAGATTTGTGAGGTTTGATTCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000076997    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021367.1-391s1c1
Sequence:CCGGCCTCACAAATTCTAAGATTGTCTCGAGACAATCTTAGAATTTGTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000076995    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021367.1-316s1c1
Sequence:CCGGGCTACCCTGAAACTGAGAGAACTCGAGTTCTCTCAGTTTCAGGGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000076994    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021367.1-418s1c1
Sequence:CCGGCCTTCATGCAATCTCCAGAATCTCGAGATTCTGGAGATTGCATGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks