EMAIL THIS PAGE TO A FRIEND

TSN

translin

Synonyms: BCLF-1 C3PO RCHF1 REHF-1 TBRBP TRSLN
UniProtKB ID: Q15631, B7Z3X8, Q5U0K7
Gene ID:
Human(7247) Summary: This gene encodes a DNA-binding protein which specifically recognizes conserved target sequences at the breakpoint junction of chromosomal translocations. Translin polypeptides form a multimeric structure that is responsible for its DNA-binding activity. Recombination-associated motifs and translin-binding sites are present at recombination hotspots and may serve as indicators of breakpoints in genes which are fused by translocations. These binding activities may play a crucial role in chromosomal translocation in lymphoid neoplasms. This protein encoded by this gene, when complexed with translin-associated protein X, also forms a Mg ion-dependent endoribonuclease that promotes RNA-induced silencing complex (RISC) activation. Alternative splicing results in multiple transcript variants. [provided by RefSeq, May 2012]
Mouse(22099) translin
Rat(60381) translin
chicken(100309740) Tibia strain
dog(483876) translin
chicken(395955) translin
cow(509943) translin
sheep(101116021) translin
194 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_011650 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011650 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011650 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_004622 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004622 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004622 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EMU188341 MISSION® esiRNA esiRNA targeting mouse Tsn mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004622 Rosetta Predictions human pricing
NM_021762 Rosetta Predictions rat pricing
NM_011650 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004622 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00184791 predicted 809
2 SASI_Hs01_00184792 predicted 445
3 SASI_Hs02_00338020 predicted 440
4 SASI_Hs01_00184793 predicted 402
5 SASI_Hs01_00184794 predicted 469
6 SASI_Hs01_00184795 predicted 400
7 SASI_Hs01_00184796 predicted 676
8 SASI_Hs01_00184797 predicted 813
9 SASI_Hs01_00184798 predicted 535
10 SASI_Hs01_00184799 predicted 570
11 SASI_Hs01_00184790 predicted 382
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021762 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00103520 predicted 339
2 SASI_Rn01_00103521 predicted 411
3 SASI_Rn01_00103522 predicted 275
4 SASI_Rn01_00103523 predicted 677
5 SASI_Rn01_00103525 predicted 251
6 SASI_Rn01_00103526 predicted 452
7 SASI_Rn01_00103527 predicted 603
8 SASI_Rn01_00103528 predicted 608
9 SASI_Rn02_00262821 predicted 464
10 SASI_Rn02_00262822 predicted 327
11 SASI_Rn01_00103524 predicted 611
12 SASI_Rn01_00103529 predicted 334
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011650 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00081796 predicted 1199
2 SASI_Mm02_00321131 predicted 1198
3 SASI_Mm01_00081797 predicted 207
4 SASI_Mm01_00081798 predicted 644
5 SASI_Mm01_00081799 predicted 210
6 SASI_Mm01_00081800 predicted 1178
7 SASI_Mm01_00081802 predicted 572
8 SASI_Mm01_00081803 predicted 513
9 SASI_Mm01_00081804 predicted 415
10 SASI_Mm02_00321132 predicted 538
11 SASI_Mm01_00081801 predicted 569
12 SASI_Mm01_00081805 predicted 1245
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011650
VALIDATED
TSN MISSION shRNA Bacterial Glycerol Stock
translin
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000175721    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: NIH/3T3
TRC Version: 1.5 Clone ID:NM_011650.2-421s1c1
Sequence:CCGGGTTACAGAGATTCTTGGCATTCTCGAGAATGCCAAGAATCTCTGTAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000175202    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: NIH/3T3
TRC Version: 1.5 Clone ID:NM_011650.2-567s1c1
Sequence:CCGGCCTTCACATTTCTACTTTCATCTCGAGATGAAAGTAGAAATGTGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000175579    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_011650.2-1548s1c1
Sequence:CCGGCCTCATGTATTCACTCCTTATCTCGAGATAAGGAGTGAATACATGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000194093    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: NIH/3T3
TRC Version: 1.5 Clone ID:NM_011650.2-478s1c1
Sequence:CCGGGAAGATTATCTCTCAGGAGTTCTCGAGAACTCCTGAGAGATAATCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000193915    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_011650.2-2024s1c1
Sequence:CCGGCCTTTCTTTCTTGGTAGCATTCTCGAGAATGCTACCAAGAAAGAAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000336125    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_011650.3-252s21c1
Sequence:CCGGAGAACATTTCAGTACAGTAAACTCGAGTTTACTGTACTGAAATGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000336126    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_011650.3-209s21c1
Sequence:CCGGGTACTGGATTTCAGGACATTCCTCGAGGAATGTCCTGAAATCCAGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000336185    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_011650.3-990s21c1
Sequence:CCGGTGCCGTGTTGTCGTCGTATTACTCGAGTAATACGACGACAACACGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000336148    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011650.3-478s21c1
Sequence:CCGGGAAGATTATCTCTCAGGAGTTCTCGAGAACTCCTGAGAGATAATCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000336183    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_011650.3-421s21c1
Sequence:CCGGGTTACAGAGATTCTTGGCATTCTCGAGAATGCCAAGAATCTCTGTAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011650
VALIDATED
TSN MISSION shRNA shRNA Plasmid DNA
translin
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000175721    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: NIH/3T3
TRC Version: 1.5 Clone ID:NM_011650.2-421s1c1
Sequence:CCGGGTTACAGAGATTCTTGGCATTCTCGAGAATGCCAAGAATCTCTGTAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000175202    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: NIH/3T3
TRC Version: 1.5 Clone ID:NM_011650.2-567s1c1
Sequence:CCGGCCTTCACATTTCTACTTTCATCTCGAGATGAAAGTAGAAATGTGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000175579    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_011650.2-1548s1c1
Sequence:CCGGCCTCATGTATTCACTCCTTATCTCGAGATAAGGAGTGAATACATGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000194093    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: NIH/3T3
TRC Version: 1.5 Clone ID:NM_011650.2-478s1c1
Sequence:CCGGGAAGATTATCTCTCAGGAGTTCTCGAGAACTCCTGAGAGATAATCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000193915    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_011650.2-2024s1c1
Sequence:CCGGCCTTTCTTTCTTGGTAGCATTCTCGAGAATGCTACCAAGAAAGAAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000336125    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_011650.3-252s21c1
Sequence:CCGGAGAACATTTCAGTACAGTAAACTCGAGTTTACTGTACTGAAATGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000336126    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_011650.3-209s21c1
Sequence:CCGGGTACTGGATTTCAGGACATTCCTCGAGGAATGTCCTGAAATCCAGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000336185    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_011650.3-990s21c1
Sequence:CCGGTGCCGTGTTGTCGTCGTATTACTCGAGTAATACGACGACAACACGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000336148    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011650.3-478s21c1
Sequence:CCGGGAAGATTATCTCTCAGGAGTTCTCGAGAACTCCTGAGAGATAATCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000336183    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_011650.3-421s21c1
Sequence:CCGGGTTACAGAGATTCTTGGCATTCTCGAGAATGCCAAGAATCTCTGTAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011650
VALIDATED
TSN MISSION shRNA Lentiviral Transduction Particles
translin
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000175721    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: NIH/3T3
TRC Version: 1.5 Clone ID:NM_011650.2-421s1c1
Sequence:CCGGGTTACAGAGATTCTTGGCATTCTCGAGAATGCCAAGAATCTCTGTAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000175202    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: NIH/3T3
TRC Version: 1.5 Clone ID:NM_011650.2-567s1c1
Sequence:CCGGCCTTCACATTTCTACTTTCATCTCGAGATGAAAGTAGAAATGTGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000175579    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_011650.2-1548s1c1
Sequence:CCGGCCTCATGTATTCACTCCTTATCTCGAGATAAGGAGTGAATACATGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000194093    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: NIH/3T3
TRC Version: 1.5 Clone ID:NM_011650.2-478s1c1
Sequence:CCGGGAAGATTATCTCTCAGGAGTTCTCGAGAACTCCTGAGAGATAATCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000193915    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_011650.2-2024s1c1
Sequence:CCGGCCTTTCTTTCTTGGTAGCATTCTCGAGAATGCTACCAAGAAAGAAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000336125    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_011650.3-252s21c1
Sequence:CCGGAGAACATTTCAGTACAGTAAACTCGAGTTTACTGTACTGAAATGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000336126    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_011650.3-209s21c1
Sequence:CCGGGTACTGGATTTCAGGACATTCCTCGAGGAATGTCCTGAAATCCAGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000336185    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_011650.3-990s21c1
Sequence:CCGGTGCCGTGTTGTCGTCGTATTACTCGAGTAATACGACGACAACACGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000336148    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011650.3-478s21c1
Sequence:CCGGGAAGATTATCTCTCAGGAGTTCTCGAGAACTCCTGAGAGATAATCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000336183    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_011650.3-421s21c1
Sequence:CCGGGTTACAGAGATTCTTGGCATTCTCGAGAATGCCAAGAATCTCTGTAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004622
VALIDATED
TSN MISSION shRNA Bacterial Glycerol Stock
translin
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000033544    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004622.2-823s1c1
Sequence:CCGGCGGATTGAAATATGACGTGAACTCGAGTTCACGTCATATTTCAATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000033546    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_004622.2-394s1c1
Sequence:CCGGCATTCCAAAGAGGTGTTTGAACTCGAGTTCAAACACCTCTTTGGAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000033548    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_004622.2-476s1c1
Sequence:CCGGGCTGAACAGTATTACAGATTTCTCGAGAAATCTGTAATACTGTTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000033547    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_004622.2-647s1c1
Sequence:CCGGGAAGATTATCTCTCAGGAGTTCTCGAGAACTCCTGAGAGATAATCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000033545    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1 Clone ID:NM_004622.2-542s1c1
Sequence:CCGGGCATTTGTTGTGTATTTGGAACTCGAGTTCCAAATACACAACAAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000349741    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_004622.2-813s21c1
Sequence:CCGGAGCGCTACGACGGATTGAAATCTCGAGATTTCAATCCGTCGTAGCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000327704    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_004622.2-394s21c1
Sequence:CCGGCATTCCAAAGAGGTGTTTGAACTCGAGTTCAAACACCTCTTTGGAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000312638    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_004622.2-1015s21c1
Sequence:CCGGTGCTAAACACTGCGCTTTATTCTCGAGAATAAAGCGCAGTGTTTAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000327715    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004622.2-647s21c1
Sequence:CCGGGAAGATTATCTCTCAGGAGTTCTCGAGAACTCCTGAGAGATAATCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000327705    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004622.2-476s21c1
Sequence:CCGGGCTGAACAGTATTACAGATTTCTCGAGAAATCTGTAATACTGTTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004622
VALIDATED
TSN MISSION shRNA shRNA Plasmid DNA
translin
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000033544    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004622.2-823s1c1
Sequence:CCGGCGGATTGAAATATGACGTGAACTCGAGTTCACGTCATATTTCAATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000033546    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_004622.2-394s1c1
Sequence:CCGGCATTCCAAAGAGGTGTTTGAACTCGAGTTCAAACACCTCTTTGGAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000033548    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_004622.2-476s1c1
Sequence:CCGGGCTGAACAGTATTACAGATTTCTCGAGAAATCTGTAATACTGTTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000033547    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_004622.2-647s1c1
Sequence:CCGGGAAGATTATCTCTCAGGAGTTCTCGAGAACTCCTGAGAGATAATCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000033545    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1 Clone ID:NM_004622.2-542s1c1
Sequence:CCGGGCATTTGTTGTGTATTTGGAACTCGAGTTCCAAATACACAACAAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000349741    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_004622.2-813s21c1
Sequence:CCGGAGCGCTACGACGGATTGAAATCTCGAGATTTCAATCCGTCGTAGCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000327704    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_004622.2-394s21c1
Sequence:CCGGCATTCCAAAGAGGTGTTTGAACTCGAGTTCAAACACCTCTTTGGAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000312638    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_004622.2-1015s21c1
Sequence:CCGGTGCTAAACACTGCGCTTTATTCTCGAGAATAAAGCGCAGTGTTTAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000327715    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004622.2-647s21c1
Sequence:CCGGGAAGATTATCTCTCAGGAGTTCTCGAGAACTCCTGAGAGATAATCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000327705    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004622.2-476s21c1
Sequence:CCGGGCTGAACAGTATTACAGATTTCTCGAGAAATCTGTAATACTGTTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004622
VALIDATED
TSN MISSION shRNA Lentiviral Transduction Particles
translin
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000033544    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004622.2-823s1c1
Sequence:CCGGCGGATTGAAATATGACGTGAACTCGAGTTCACGTCATATTTCAATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000033546    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_004622.2-394s1c1
Sequence:CCGGCATTCCAAAGAGGTGTTTGAACTCGAGTTCAAACACCTCTTTGGAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000033548    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_004622.2-476s1c1
Sequence:CCGGGCTGAACAGTATTACAGATTTCTCGAGAAATCTGTAATACTGTTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000033547    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_004622.2-647s1c1
Sequence:CCGGGAAGATTATCTCTCAGGAGTTCTCGAGAACTCCTGAGAGATAATCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000033545    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1 Clone ID:NM_004622.2-542s1c1
Sequence:CCGGGCATTTGTTGTGTATTTGGAACTCGAGTTCCAAATACACAACAAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000349741    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_004622.2-813s21c1
Sequence:CCGGAGCGCTACGACGGATTGAAATCTCGAGATTTCAATCCGTCGTAGCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000327704    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_004622.2-394s21c1
Sequence:CCGGCATTCCAAAGAGGTGTTTGAACTCGAGTTCAAACACCTCTTTGGAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000312638    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_004622.2-1015s21c1
Sequence:CCGGTGCTAAACACTGCGCTTTATTCTCGAGAATAAAGCGCAGTGTTTAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000327715    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004622.2-647s21c1
Sequence:CCGGGAAGATTATCTCTCAGGAGTTCTCGAGAACTCCTGAGAGATAATCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000327705    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004622.2-476s21c1
Sequence:CCGGGCTGAACAGTATTACAGATTTCTCGAGAAATCTGTAATACTGTTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks