EMAIL THIS PAGE TO A FRIEND

TSNARE1

t-SNARE domain containing 1

UniProtKB ID: Q96NA8, Q14D03
Gene ID:
chicken(420304) t-SNARE domain containing 1
domestic cat(101086205) t-SNARE domain containing 1
Horse(100054312) t-SNARE domain containing 1
dog(482064) t-SNARE domain containing 1
cow(535306) t-SNARE domain containing 1
naked mole-rat(101715985) t-SNARE domain containing 1
64 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_145003 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_145003 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_145003 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU011391 MISSION® esiRNA esiRNA targeting human TSNARE1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_145003 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145003 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00084489 predicted 1402
2 SASI_Hs01_00084490 predicted 1165
3 SASI_Hs02_00364842 predicted 1631
4 SASI_Hs01_00084491 predicted 1458
5 SASI_Hs01_00084492 predicted 203
6 SASI_Hs01_00084493 predicted 905
7 SASI_Hs01_00084494 predicted 1144
8 SASI_Hs01_00084495 predicted 1399
9 SASI_Hs01_00084497 predicted 913
10 SASI_Hs01_00084498 predicted 205
11 SASI_Hs01_00084496 predicted 320
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_145003
TSNARE1 MISSION shRNA Bacterial Glycerol Stock
t-SNARE domain containing 1
Human
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000145186    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145003.1-1614s1c1
Sequence:CCGGGCTTGTCATCATCATCATCATCTCGAGATGATGATGATGATGACAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000144891    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145003.1-1422s1c1
Sequence:CCGGGAATCAGATCATCAAGGACTTCTCGAGAAGTCCTTGATGATCTGATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000142502    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145003.1-1477s1c1
Sequence:CCGGGATAGTATTGAAGCCAGCCTTCTCGAGAAGGCTGGCTTCAATACTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000139680    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145003.1-222s1c1
Sequence:CCGGCGAGTATGGAATCCGCCATTTCTCGAGAAATGGCGGATTCCATACTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000139628    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145003.1-911s1c1
Sequence:CCGGCCAACGTCTTCCGAATCAACTCTCGAGAGTTGATTCGGAAGACGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000139589    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145003.1-1021s1c1
Sequence:CCGGCAGGAGACCAACAAGACCATTCTCGAGAATGGTCTTGTTGGTCTCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000139612    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145003.1-1572s1c1
Sequence:CCGGCAAGATCAAGTGCTGCTTCCTCTCGAGAGGAAGCAGCACTTGATCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000139660    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145003.1-1284s1c1
Sequence:CCGGGAAGGTCTTTAACGGGAGTGACTCGAGTCACTCCCGTTAAAGACCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000139719    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145003.1-1557s1c1
Sequence:CCGGCCAACTCCAGAGACACAAGATCTCGAGATCTTGTGTCTCTGGAGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000139991    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145003.1-208s1c1
Sequence:CCGGGCTAGATGTTGGACCGAGTATCTCGAGATACTCGGTCCAACATCTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000142437    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145003.1-1273s1c1
Sequence:CCGGGCTGATGATGAGAAGGTCTTTCTCGAGAAAGACCTTCTCATCATCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000140016    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145003.1-1459s1c1
Sequence:CCGGGAGCAAGGAGAAGCTGTTGATCTCGAGATCAACAGCTTCTCCTTGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000140488    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145003.1-1282s1c1
Sequence:CCGGGAGAAGGTCTTTAACGGGAGTCTCGAGACTCCCGTTAAAGACCTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_145003
TSNARE1 MISSION shRNA shRNA Plasmid DNA
t-SNARE domain containing 1
Human
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000145186    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145003.1-1614s1c1
Sequence:CCGGGCTTGTCATCATCATCATCATCTCGAGATGATGATGATGATGACAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000144891    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145003.1-1422s1c1
Sequence:CCGGGAATCAGATCATCAAGGACTTCTCGAGAAGTCCTTGATGATCTGATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000142502    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145003.1-1477s1c1
Sequence:CCGGGATAGTATTGAAGCCAGCCTTCTCGAGAAGGCTGGCTTCAATACTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000139680    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145003.1-222s1c1
Sequence:CCGGCGAGTATGGAATCCGCCATTTCTCGAGAAATGGCGGATTCCATACTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000139628    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145003.1-911s1c1
Sequence:CCGGCCAACGTCTTCCGAATCAACTCTCGAGAGTTGATTCGGAAGACGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000139589    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145003.1-1021s1c1
Sequence:CCGGCAGGAGACCAACAAGACCATTCTCGAGAATGGTCTTGTTGGTCTCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000139612    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145003.1-1572s1c1
Sequence:CCGGCAAGATCAAGTGCTGCTTCCTCTCGAGAGGAAGCAGCACTTGATCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000139660    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145003.1-1284s1c1
Sequence:CCGGGAAGGTCTTTAACGGGAGTGACTCGAGTCACTCCCGTTAAAGACCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000139719    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145003.1-1557s1c1
Sequence:CCGGCCAACTCCAGAGACACAAGATCTCGAGATCTTGTGTCTCTGGAGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000139991    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145003.1-208s1c1
Sequence:CCGGGCTAGATGTTGGACCGAGTATCTCGAGATACTCGGTCCAACATCTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000142437    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145003.1-1273s1c1
Sequence:CCGGGCTGATGATGAGAAGGTCTTTCTCGAGAAAGACCTTCTCATCATCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000140016    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145003.1-1459s1c1
Sequence:CCGGGAGCAAGGAGAAGCTGTTGATCTCGAGATCAACAGCTTCTCCTTGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000140488    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145003.1-1282s1c1
Sequence:CCGGGAGAAGGTCTTTAACGGGAGTCTCGAGACTCCCGTTAAAGACCTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_145003
TSNARE1 MISSION shRNA Lentiviral Transduction Particles
t-SNARE domain containing 1
Human
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000145186    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145003.1-1614s1c1
Sequence:CCGGGCTTGTCATCATCATCATCATCTCGAGATGATGATGATGATGACAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000144891    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145003.1-1422s1c1
Sequence:CCGGGAATCAGATCATCAAGGACTTCTCGAGAAGTCCTTGATGATCTGATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000142502    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145003.1-1477s1c1
Sequence:CCGGGATAGTATTGAAGCCAGCCTTCTCGAGAAGGCTGGCTTCAATACTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000139680    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145003.1-222s1c1
Sequence:CCGGCGAGTATGGAATCCGCCATTTCTCGAGAAATGGCGGATTCCATACTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000139628    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145003.1-911s1c1
Sequence:CCGGCCAACGTCTTCCGAATCAACTCTCGAGAGTTGATTCGGAAGACGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000139589    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145003.1-1021s1c1
Sequence:CCGGCAGGAGACCAACAAGACCATTCTCGAGAATGGTCTTGTTGGTCTCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000139612    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145003.1-1572s1c1
Sequence:CCGGCAAGATCAAGTGCTGCTTCCTCTCGAGAGGAAGCAGCACTTGATCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000139660    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145003.1-1284s1c1
Sequence:CCGGGAAGGTCTTTAACGGGAGTGACTCGAGTCACTCCCGTTAAAGACCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000139719    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145003.1-1557s1c1
Sequence:CCGGCCAACTCCAGAGACACAAGATCTCGAGATCTTGTGTCTCTGGAGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000139991    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145003.1-208s1c1
Sequence:CCGGGCTAGATGTTGGACCGAGTATCTCGAGATACTCGGTCCAACATCTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000142437    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145003.1-1273s1c1
Sequence:CCGGGCTGATGATGAGAAGGTCTTTCTCGAGAAAGACCTTCTCATCATCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000140016    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145003.1-1459s1c1
Sequence:CCGGGAGCAAGGAGAAGCTGTTGATCTCGAGATCAACAGCTTCTCCTTGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000140488    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145003.1-1282s1c1
Sequence:CCGGGAGAAGGTCTTTAACGGGAGTCTCGAGACTCCCGTTAAAGACCTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks