EMAIL THIS PAGE TO A FRIEND

TSNAX

translin-associated factor X

Synonyms: TRAX
UniProtKB ID: Q99598, B1APC6
Gene ID:
Human(7257) Summary: This gene encodes a protein which specifically interacts with translin, a DNA-binding protein that binds consensus sequences at breakpoint junctions of chromosomal translocations. The encoded protein contains bipartite nuclear targeting sequences that may provide nuclear transport for translin, which lacks any nuclear targeting motifs. [provided by RefSeq, Jul 2008]
Mouse(53424) translin-associated factor X
Rat(64028) translin-associated factor X
domestic guinea pig(100731856) translin-associated factor X
cow(533927) translin-associated factor X
sheep(101111933) translin-associated factor X
Zebrafish(556657) translin-associated factor X
domestic cat(101088189) translin-associated factor X
dog(479203) translin-associated factor X
chicken(421526) translin-associated factor X
93 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_016909 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_016909 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_016909 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_005999 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005999 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005999 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005999 Rosetta Predictions human pricing
NM_022262 Rosetta Predictions rat pricing
NM_016909 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005999 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00173466 predicted 320
2 SASI_Hs01_00173467 predicted 1068
3 SASI_Hs01_00173468 predicted 449
4 SASI_Hs01_00173469 predicted 856
5 SASI_Hs01_00173470 predicted 578
6 SASI_Hs01_00173471 predicted 288
7 SASI_Hs01_00173472 predicted 196
8 SASI_Hs01_00173473 predicted 234
9 SASI_Hs01_00173474 predicted 292
10 SASI_Hs01_00173475 predicted 1066
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022262 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00059544 predicted 257
2 SASI_Rn01_00059545 predicted 216
3 SASI_Rn01_00059546 predicted 1004
4 SASI_Rn01_00059547 predicted 1017
5 SASI_Rn01_00059548 predicted 477
6 SASI_Rn01_00059549 predicted 212
7 SASI_Rn01_00059550 predicted 271
8 SASI_Rn01_00059552 predicted 253
9 SASI_Rn01_00059553 predicted 931
10 SASI_Rn02_00263064 predicted 1024
11 SASI_Rn01_00059551 predicted 521
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016909 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00127195 predicted 395
2 SASI_Mm01_00127196 predicted 377
3 SASI_Mm02_00323761 predicted 833
4 SASI_Mm02_00323762 predicted 236
5 SASI_Mm02_00323763 predicted 364
6 SASI_Mm02_00323764 predicted 960
7 SASI_Mm02_00323765 predicted 442
8 SASI_Mm02_00323766 predicted 422
9 SASI_Mm02_00323767 predicted 486
10 SASI_Mm02_00323768 predicted 937
11 SASI_Mm01_00127187 predicted 1168
12 SASI_Mm01_00127188 predicted 1178
13 SASI_Mm01_00127189 predicted 780
14 SASI_Mm01_00127190 predicted 795
15 SASI_Mm01_00127191 predicted 1121
16 SASI_Mm01_00127192 predicted 1169
17 SASI_Mm01_00127193 predicted 915
18 SASI_Mm01_00127194 predicted 903
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016909
TSNAX MISSION shRNA Bacterial Glycerol Stock
translin-associated factor X
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000193301    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016909.1-618s1c1
Sequence:CCGGCGTTCATTGATCAGTATGGAACTCGAGTTCCATACTGATCAATGAACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000174862    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016909.1-641s1c1
Sequence:CCGGGATTAACAAGCAGTTGACATTCTCGAGAATGTCAACTGCTTGTTAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000240849    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016909.2-964s21c1
Sequence:CCGGACGCTTGCTATGCCCTTAAAGCTCGAGCTTTAAGGGCATAGCAAGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000240852    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016909.2-339s21c1
Sequence:CCGGGACGCCAGGCACGACAAATATCTCGAGATATTTGTCGTGCCTGGCGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000240853    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016909.2-1265s21c1
Sequence:CCGGTGTATATGTGCTCGCTCTATTCTCGAGAATAGAGCGAGCACATATACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000219463    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016909.2-370s1c1
Sequence:CCGGTGAAGCTAAGCCGGGATATTACTCGAGTAATATCCCGGCTTAGCTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000219464    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016909.2-874s1c1
Sequence:CCGGACGATGGGTTCTCGTTCATTGCTCGAGCAATGAACGAGAACCCATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000240851    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016909.2-1049s21c1
Sequence:CCGGTGATCAGGAAGAGAGCATTTCCTCGAGGAAATGCTCTCTTCCTGATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000240850    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016909.2-301s21c1
Sequence:CCGGCGGTGATGCTGGCCTTCAAATCTCGAGATTTGAAGGCCAGCATCACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016909
TSNAX MISSION shRNA shRNA Plasmid DNA
translin-associated factor X
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000193301    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016909.1-618s1c1
Sequence:CCGGCGTTCATTGATCAGTATGGAACTCGAGTTCCATACTGATCAATGAACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000174862    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016909.1-641s1c1
Sequence:CCGGGATTAACAAGCAGTTGACATTCTCGAGAATGTCAACTGCTTGTTAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000240849    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016909.2-964s21c1
Sequence:CCGGACGCTTGCTATGCCCTTAAAGCTCGAGCTTTAAGGGCATAGCAAGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000240852    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016909.2-339s21c1
Sequence:CCGGGACGCCAGGCACGACAAATATCTCGAGATATTTGTCGTGCCTGGCGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000240853    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016909.2-1265s21c1
Sequence:CCGGTGTATATGTGCTCGCTCTATTCTCGAGAATAGAGCGAGCACATATACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000219463    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016909.2-370s1c1
Sequence:CCGGTGAAGCTAAGCCGGGATATTACTCGAGTAATATCCCGGCTTAGCTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000219464    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016909.2-874s1c1
Sequence:CCGGACGATGGGTTCTCGTTCATTGCTCGAGCAATGAACGAGAACCCATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000240851    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016909.2-1049s21c1
Sequence:CCGGTGATCAGGAAGAGAGCATTTCCTCGAGGAAATGCTCTCTTCCTGATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000240850    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016909.2-301s21c1
Sequence:CCGGCGGTGATGCTGGCCTTCAAATCTCGAGATTTGAAGGCCAGCATCACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016909
TSNAX MISSION shRNA Lentiviral Transduction Particles
translin-associated factor X
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000193301    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016909.1-618s1c1
Sequence:CCGGCGTTCATTGATCAGTATGGAACTCGAGTTCCATACTGATCAATGAACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000174862    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016909.1-641s1c1
Sequence:CCGGGATTAACAAGCAGTTGACATTCTCGAGAATGTCAACTGCTTGTTAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000240849    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016909.2-964s21c1
Sequence:CCGGACGCTTGCTATGCCCTTAAAGCTCGAGCTTTAAGGGCATAGCAAGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000240852    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016909.2-339s21c1
Sequence:CCGGGACGCCAGGCACGACAAATATCTCGAGATATTTGTCGTGCCTGGCGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000240853    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016909.2-1265s21c1
Sequence:CCGGTGTATATGTGCTCGCTCTATTCTCGAGAATAGAGCGAGCACATATACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000219463    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016909.2-370s1c1
Sequence:CCGGTGAAGCTAAGCCGGGATATTACTCGAGTAATATCCCGGCTTAGCTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000219464    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016909.2-874s1c1
Sequence:CCGGACGATGGGTTCTCGTTCATTGCTCGAGCAATGAACGAGAACCCATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000240851    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016909.2-1049s21c1
Sequence:CCGGTGATCAGGAAGAGAGCATTTCCTCGAGGAAATGCTCTCTTCCTGATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000240850    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016909.2-301s21c1
Sequence:CCGGCGGTGATGCTGGCCTTCAAATCTCGAGATTTGAAGGCCAGCATCACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005999
TSNAX MISSION shRNA Bacterial Glycerol Stock
translin-associated factor X
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000166385    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_005999.2-2301s1c1
Sequence:CCGGCCAGACCTTTAGTTGTCCCATCTCGAGATGGGACAACTAAAGGTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000160813    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_005999.2-2496s1c1
Sequence:CCGGCCAGACATTTCCAGTTGGTTTCTCGAGAAACCAACTGGAAATGTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000160626    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_005999.2-1678s1c1
Sequence:CCGGCGTCTCTACTAGAAATACAAACTCGAGTTTGTATTTCTAGTAGAGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000160011    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005999.2-339s1c1
Sequence:CCGGCGGGATATAACTGTTGAAAGTCTCGAGACTTTCAACAGTTATATCCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000158648    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005999.2-920s1c1
Sequence:CCGGGAATGCTTGTTATGCCTTGAACTCGAGTTCAAGGCATAACAAGCATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000158872    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_005999.2-2166s1c1
Sequence:CCGGGCTTTCCTATTCTAGCATTTACTCGAGTAAATGCTAGAATAGGAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000160261    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005999.2-306s1c1
Sequence:CCGGCATGACAAATATGAGAGACTTCTCGAGAAGTCTCTCATATTTGTCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000161523    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005999.2-1004s1c1
Sequence:CCGGGATAGATCAAGAAGAGGGCATCTCGAGATGCCCTCTTCTTGATCTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000165265    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005999.2-698s1c1
Sequence:CCGGGAGAGTCACACCTGTCGATTACTCGAGTAATCGACAGGTGTGACTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005999
TSNAX MISSION shRNA shRNA Plasmid DNA
translin-associated factor X
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000166385    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_005999.2-2301s1c1
Sequence:CCGGCCAGACCTTTAGTTGTCCCATCTCGAGATGGGACAACTAAAGGTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000160813    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_005999.2-2496s1c1
Sequence:CCGGCCAGACATTTCCAGTTGGTTTCTCGAGAAACCAACTGGAAATGTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000160626    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_005999.2-1678s1c1
Sequence:CCGGCGTCTCTACTAGAAATACAAACTCGAGTTTGTATTTCTAGTAGAGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000160011    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005999.2-339s1c1
Sequence:CCGGCGGGATATAACTGTTGAAAGTCTCGAGACTTTCAACAGTTATATCCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000158648    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005999.2-920s1c1
Sequence:CCGGGAATGCTTGTTATGCCTTGAACTCGAGTTCAAGGCATAACAAGCATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000158872    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_005999.2-2166s1c1
Sequence:CCGGGCTTTCCTATTCTAGCATTTACTCGAGTAAATGCTAGAATAGGAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000160261    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005999.2-306s1c1
Sequence:CCGGCATGACAAATATGAGAGACTTCTCGAGAAGTCTCTCATATTTGTCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000161523    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005999.2-1004s1c1
Sequence:CCGGGATAGATCAAGAAGAGGGCATCTCGAGATGCCCTCTTCTTGATCTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000165265    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005999.2-698s1c1
Sequence:CCGGGAGAGTCACACCTGTCGATTACTCGAGTAATCGACAGGTGTGACTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005999
TSNAX MISSION shRNA Lentiviral Transduction Particles
translin-associated factor X
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000166385    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_005999.2-2301s1c1
Sequence:CCGGCCAGACCTTTAGTTGTCCCATCTCGAGATGGGACAACTAAAGGTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000160813    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_005999.2-2496s1c1
Sequence:CCGGCCAGACATTTCCAGTTGGTTTCTCGAGAAACCAACTGGAAATGTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000160626    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_005999.2-1678s1c1
Sequence:CCGGCGTCTCTACTAGAAATACAAACTCGAGTTTGTATTTCTAGTAGAGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000160011    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005999.2-339s1c1
Sequence:CCGGCGGGATATAACTGTTGAAAGTCTCGAGACTTTCAACAGTTATATCCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000158648    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005999.2-920s1c1
Sequence:CCGGGAATGCTTGTTATGCCTTGAACTCGAGTTCAAGGCATAACAAGCATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000158872    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_005999.2-2166s1c1
Sequence:CCGGGCTTTCCTATTCTAGCATTTACTCGAGTAAATGCTAGAATAGGAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000160261    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005999.2-306s1c1
Sequence:CCGGCATGACAAATATGAGAGACTTCTCGAGAAGTCTCTCATATTTGTCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000161523    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005999.2-1004s1c1
Sequence:CCGGGATAGATCAAGAAGAGGGCATCTCGAGATGCCCTCTTCTTGATCTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000165265    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005999.2-698s1c1
Sequence:CCGGGAGAGTCACACCTGTCGATTACTCGAGTAATCGACAGGTGTGACTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks