EMAIL THIS PAGE TO A FRIEND

TSNAXIP1

translin-associated factor X interacting protein 1

Synonyms: TXI1
UniProtKB ID: Q2TAA8, Q9P105
Gene ID:
Mouse(72236) translin-associated factor X (Tsnax) interacting protein 1
Rat(498944) translin-associated factor X interacting protein 1
Zebrafish(565917) translin-associated factor X interacting protein 1
chicken(769262) translin-associated factor X interacting protein 1
domestic cat(101080674) translin-associated factor X interacting protein 1
dog(479682) translin-associated factor X interacting protein 1
cow(527504) translin-associated factor X interacting protein 1
sheep(101109559) translin-associated factor X interacting protein 1
domestic guinea pig(100729095) translin-associated factor X interacting protein 1
naked mole-rat(101705857) translin-associated factor X interacting protein 1
89 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_024445 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_024445 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_024445 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_018430 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_018430 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_018430 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_018430 Rosetta Predictions human pricing
NM_001109130 Rosetta Predictions rat pricing
NM_024445 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018430 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00066868 predicted 2117
2 SASI_Hs01_00066870 predicted 2089
3 SASI_Hs02_00351953 predicted 968
4 SASI_Hs02_00351954 predicted 618
5 SASI_Hs02_00351955 predicted 628
6 SASI_Hs02_00351956 predicted 602
7 SASI_Hs02_00351957 predicted 759
8 SASI_Hs01_00066874 predicted 1564
9 SASI_Hs01_00066875 predicted 1867
10 SASI_Hs01_00066876 predicted 1998
11 SASI_Hs01_00066869 predicted 1461
12 SASI_Hs01_00066871 predicted 1363
13 SASI_Hs01_00066872 predicted 1077
14 SASI_Hs01_00066873 predicted 1457
15 SASI_Hs01_00066877 predicted 1255
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001109130 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00245420 predicted 573
2 SASI_Rn02_00245421 predicted 2044
3 SASI_Rn02_00245422 predicted 1599
4 SASI_Rn02_00245423 predicted 254
5 SASI_Rn02_00245424 predicted 476
6 SASI_Rn02_00245425 predicted 366
7 SASI_Rn02_00245426 predicted 445
8 SASI_Rn02_00245427 predicted 1712
9 SASI_Rn02_00245428 predicted 2096
10 SASI_Rn02_00245429 predicted 1015
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024445 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00327782 predicted 665
2 SASI_Mm01_00127007 predicted 1627
3 SASI_Mm01_00127008 predicted 1014
4 SASI_Mm01_00127009 predicted 1779
5 SASI_Mm01_00127010 predicted 631
6 SASI_Mm01_00127011 predicted 401
7 SASI_Mm01_00127012 predicted 609
8 SASI_Mm01_00127013 predicted 1536
9 SASI_Mm02_00327783 predicted 952
10 SASI_Mm01_00127014 predicted 439
11 SASI_Mm01_00127015 predicted 1576
12 SASI_Mm01_00127016 predicted 985
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024445
TSNAXIP1 MISSION shRNA Bacterial Glycerol Stock
translin-associated factor X interacting protein 1
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000257181    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024445.4-1152s21c1
Sequence:CCGGCCAAATGCGAAAGTATCATAGCTCGAGCTATGATACTTTCGCATTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000215806    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024445.4-1152s1c1
Sequence:CCGGCCAAATGCGAAAGTATCATAGCTCGAGCTATGATACTTTCGCATTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000243867    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024445.4-194s21c1
Sequence:CCGGCTGTCACCATGGCCTACATACCTCGAGGTATGTAGGCCATGGTGACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000243868    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024445.4-848s21c1
Sequence:CCGGGACCCAGTGAAGCTAACATTGCTCGAGCAATGTTAGCTTCACTGGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000243866    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024445.4-1085s21c1
Sequence:CCGGGAGCGGGACCAGTTCTATAATCTCGAGATTATAGAACTGGTCCCGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000243869    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024445.4-898s21c1
Sequence:CCGGTCGCACACAGATGGAACTTAACTCGAGTTAAGTTCCATCTGTGTGCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000183693    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024445.2-1544s1c1
Sequence:CCGGGAATCAGTTCTATGCAGTATTCTCGAGAATACTGCATAGAACTGATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000179679    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024445.2-127s1c1
Sequence:CCGGGCATTGAGAAACGCAAGCTTTCTCGAGAAAGCTTGCGTTTCTCAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000184651    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024445.2-1520s1c1
Sequence:CCGGGCTCTTTCGTTCCAGTGAGATCTCGAGATCTCACTGGAACGAAAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024445
TSNAXIP1 MISSION shRNA shRNA Plasmid DNA
translin-associated factor X interacting protein 1
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000257181    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024445.4-1152s21c1
Sequence:CCGGCCAAATGCGAAAGTATCATAGCTCGAGCTATGATACTTTCGCATTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000215806    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024445.4-1152s1c1
Sequence:CCGGCCAAATGCGAAAGTATCATAGCTCGAGCTATGATACTTTCGCATTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000243867    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024445.4-194s21c1
Sequence:CCGGCTGTCACCATGGCCTACATACCTCGAGGTATGTAGGCCATGGTGACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000243868    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024445.4-848s21c1
Sequence:CCGGGACCCAGTGAAGCTAACATTGCTCGAGCAATGTTAGCTTCACTGGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000243866    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024445.4-1085s21c1
Sequence:CCGGGAGCGGGACCAGTTCTATAATCTCGAGATTATAGAACTGGTCCCGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000243869    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024445.4-898s21c1
Sequence:CCGGTCGCACACAGATGGAACTTAACTCGAGTTAAGTTCCATCTGTGTGCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000183693    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024445.2-1544s1c1
Sequence:CCGGGAATCAGTTCTATGCAGTATTCTCGAGAATACTGCATAGAACTGATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000179679    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024445.2-127s1c1
Sequence:CCGGGCATTGAGAAACGCAAGCTTTCTCGAGAAAGCTTGCGTTTCTCAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000184651    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024445.2-1520s1c1
Sequence:CCGGGCTCTTTCGTTCCAGTGAGATCTCGAGATCTCACTGGAACGAAAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024445
TSNAXIP1 MISSION shRNA Lentiviral Transduction Particles
translin-associated factor X interacting protein 1
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000257181    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024445.4-1152s21c1
Sequence:CCGGCCAAATGCGAAAGTATCATAGCTCGAGCTATGATACTTTCGCATTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000215806    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024445.4-1152s1c1
Sequence:CCGGCCAAATGCGAAAGTATCATAGCTCGAGCTATGATACTTTCGCATTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000243867    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024445.4-194s21c1
Sequence:CCGGCTGTCACCATGGCCTACATACCTCGAGGTATGTAGGCCATGGTGACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000243868    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024445.4-848s21c1
Sequence:CCGGGACCCAGTGAAGCTAACATTGCTCGAGCAATGTTAGCTTCACTGGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000243866    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024445.4-1085s21c1
Sequence:CCGGGAGCGGGACCAGTTCTATAATCTCGAGATTATAGAACTGGTCCCGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000243869    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024445.4-898s21c1
Sequence:CCGGTCGCACACAGATGGAACTTAACTCGAGTTAAGTTCCATCTGTGTGCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000183693    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024445.2-1544s1c1
Sequence:CCGGGAATCAGTTCTATGCAGTATTCTCGAGAATACTGCATAGAACTGATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000179679    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024445.2-127s1c1
Sequence:CCGGGCATTGAGAAACGCAAGCTTTCTCGAGAAAGCTTGCGTTTCTCAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000184651    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024445.2-1520s1c1
Sequence:CCGGGCTCTTTCGTTCCAGTGAGATCTCGAGATCTCACTGGAACGAAAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018430
TSNAXIP1 MISSION shRNA Bacterial Glycerol Stock
translin-associated factor X interacting protein 1
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000162975    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018430.1-1548s1c1
Sequence:CCGGGCTGCTGAAGGAGATGACAAACTCGAGTTTGTCATCTCCTTCAGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000160785    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018430.1-1806s1c1
Sequence:CCGGCGAGTACTTACAGCAGCTAAACTCGAGTTTAGCTGCTGTAAGTACTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000161175    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018430.1-1512s1c1
Sequence:CCGGGAATGTGTATGTCACCCAGAACTCGAGTTCTGGGTGACATACACATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000161588    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018430.1-1473s1c1
Sequence:CCGGGAGTCAGTTCTATGCAGTCTTCTCGAGAAGACTGCATAGAACTGACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000162106    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018430.1-1461s1c1
Sequence:CCGGCAACGAGGTTATGAGTCAGTTCTCGAGAACTGACTCATAACCTCGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000162387    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018430.1-1701s1c1
Sequence:CCGGCAATGCAGACTTGCTCAACTACTCGAGTAGTTGAGCAAGTCTGCATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000162704    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018430.1-1637s1c1
Sequence:CCGGCTCTCAAGACAGAAGAGCAAACTCGAGTTTGCTCTTCTGTCTTGAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000137054    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018430.1-1460s1c1
Sequence:CCGGCCAACGAGGTTATGAGTCAGTCTCGAGACTGACTCATAACCTCGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000134949    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018430.1-1359s1c1
Sequence:CCGGGTTCCCAGATTTCTTCTTCAACTCGAGTTGAAGAAGAAATCTGGGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000136678    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018430.1-1831s1c1
Sequence:CCGGGAGCTTGGCATAGAACTCCATCTCGAGATGGAGTTCTATGCCAAGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018430
TSNAXIP1 MISSION shRNA shRNA Plasmid DNA
translin-associated factor X interacting protein 1
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000162975    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018430.1-1548s1c1
Sequence:CCGGGCTGCTGAAGGAGATGACAAACTCGAGTTTGTCATCTCCTTCAGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000160785    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018430.1-1806s1c1
Sequence:CCGGCGAGTACTTACAGCAGCTAAACTCGAGTTTAGCTGCTGTAAGTACTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000161175    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018430.1-1512s1c1
Sequence:CCGGGAATGTGTATGTCACCCAGAACTCGAGTTCTGGGTGACATACACATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000161588    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018430.1-1473s1c1
Sequence:CCGGGAGTCAGTTCTATGCAGTCTTCTCGAGAAGACTGCATAGAACTGACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000162106    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018430.1-1461s1c1
Sequence:CCGGCAACGAGGTTATGAGTCAGTTCTCGAGAACTGACTCATAACCTCGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000162387    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018430.1-1701s1c1
Sequence:CCGGCAATGCAGACTTGCTCAACTACTCGAGTAGTTGAGCAAGTCTGCATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000162704    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018430.1-1637s1c1
Sequence:CCGGCTCTCAAGACAGAAGAGCAAACTCGAGTTTGCTCTTCTGTCTTGAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000137054    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018430.1-1460s1c1
Sequence:CCGGCCAACGAGGTTATGAGTCAGTCTCGAGACTGACTCATAACCTCGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000134949    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018430.1-1359s1c1
Sequence:CCGGGTTCCCAGATTTCTTCTTCAACTCGAGTTGAAGAAGAAATCTGGGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000136678    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018430.1-1831s1c1
Sequence:CCGGGAGCTTGGCATAGAACTCCATCTCGAGATGGAGTTCTATGCCAAGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018430
TSNAXIP1 MISSION shRNA Lentiviral Transduction Particles
translin-associated factor X interacting protein 1
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000162975    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018430.1-1548s1c1
Sequence:CCGGGCTGCTGAAGGAGATGACAAACTCGAGTTTGTCATCTCCTTCAGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000160785    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018430.1-1806s1c1
Sequence:CCGGCGAGTACTTACAGCAGCTAAACTCGAGTTTAGCTGCTGTAAGTACTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000161175    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018430.1-1512s1c1
Sequence:CCGGGAATGTGTATGTCACCCAGAACTCGAGTTCTGGGTGACATACACATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000161588    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018430.1-1473s1c1
Sequence:CCGGGAGTCAGTTCTATGCAGTCTTCTCGAGAAGACTGCATAGAACTGACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000162106    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018430.1-1461s1c1
Sequence:CCGGCAACGAGGTTATGAGTCAGTTCTCGAGAACTGACTCATAACCTCGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000162387    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018430.1-1701s1c1
Sequence:CCGGCAATGCAGACTTGCTCAACTACTCGAGTAGTTGAGCAAGTCTGCATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000162704    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018430.1-1637s1c1
Sequence:CCGGCTCTCAAGACAGAAGAGCAAACTCGAGTTTGCTCTTCTGTCTTGAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000137054    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018430.1-1460s1c1
Sequence:CCGGCCAACGAGGTTATGAGTCAGTCTCGAGACTGACTCATAACCTCGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000134949    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018430.1-1359s1c1
Sequence:CCGGGTTCCCAGATTTCTTCTTCAACTCGAGTTGAAGAAGAAATCTGGGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000136678    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018430.1-1831s1c1
Sequence:CCGGGAGCTTGGCATAGAACTCCATCTCGAGATGGAGTTCTATGCCAAGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks