EMAIL THIS PAGE TO A FRIEND

TSPAN10

tetraspanin 10

Synonyms: OCSP
UniProtKB ID: Q9H1Z9, Q8N548
Gene ID:
Mouse(208634) tetraspanin 10
naked mole-rat(101726222) tetraspanin 10
cow(617766) tetraspanin 10
sheep(101108586) tetraspanin 10
chicken(417455) tetraspanin 10
dog(483364) tetraspanin 10
domestic cat(101098179) tetraspanin 10
33 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB2102589 Anti-TSPAN10 antibody produced in rabbit affinity isolated antibody human
western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_145363 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_145363 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_145363 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_031945 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_031945 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_031945 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_031945 Rosetta Predictions human pricing
NM_145363 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031945 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00158953 predicted 310
2 SASI_Hs01_00158960 predicted 306
3 SASI_Hs01_00158956 predicted 750
4 SASI_Hs02_00359101 predicted 528
5 SASI_Hs02_00359102 predicted 530
6 SASI_Hs01_00158957 predicted 686
7 SASI_Hs01_00158958 predicted 661
8 SASI_Hs01_00158959 predicted 751
9 SASI_Hs02_00359103 predicted 496
10 SASI_Hs01_00158962 predicted 708
11 SASI_Hs01_00158954 predicted 241
12 SASI_Hs01_00158955 predicted 241
13 SASI_Hs01_00158961 predicted 511
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145363 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00021934 predicted 614
2 SASI_Mm01_00021935 predicted 1261
3 SASI_Mm01_00021936 predicted 741
4 SASI_Mm01_00021937 predicted 617
5 SASI_Mm01_00021938 predicted 743
6 SASI_Mm01_00021939 predicted 1105
7 SASI_Mm02_00340634 predicted 1134
8 SASI_Mm01_00021940 predicted 297
9 SASI_Mm01_00021941 predicted 297
10 SASI_Mm01_00021942 predicted 1292
11 SASI_Mm01_00021943 predicted 1257
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_145363
VALIDATED
TSPAN10 MISSION shRNA Bacterial Glycerol Stock
tetraspanin 10
Mouse
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000382400    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145363.1-644s21c1
Sequence:GTACCGGTGCAGCCATCATTCACTACTGCTCGAGCAGTAGTGAATGATGGCTGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000382338    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145363.1-297s21c1
Sequence:GTACCGGGGGAGCAACTGTGTCAAATATCTCGAGATATTTGACACAGTTGCTCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000380639    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145363.1-502s21c1
Sequence:GTACCGGTGGGTGCTTTCTGTGAGAATACTCGAGTATTCTCACAGAAAGCACCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000381151    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145363.1-191s21c1
Sequence:GTACCGGAGCACCCTGGGAGAATCAGAACTCGAGTTCTGATTCTCCCAGGGTGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000381465    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145363.1-1201s21c1
Sequence:GTACCGGCTTTGCTACAACTGGGATATCCTCGAGGATATCCCAGTTGTAGCAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000380033    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145363.1-1252s21c1
Sequence:GTACCGGTGCTGCTCTAATCTCACAATTCTCGAGAATTGTGAGATTAGAGCAGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000381739    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145363.1-1428s21c1
Sequence:GTACCGGTGATCTATCTCACGCTGACTACTCGAGTAGTCAGCGTGAGATAGATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000094619    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145363.1-1253s1c1
Sequence:CCGGGCTGCTCTAATCTCACAATTTCTCGAGAAATTGTGAGATTAGAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000094620    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_145363.1-648s1c1
Sequence:CCGGGCCATCATTCACTACTGGGATCTCGAGATCCCAGTAGTGAATGATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000094622    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_145363.1-746s1c1
Sequence:CCGGGCAACAGAACCTGTACTTTAACTCGAGTTAAAGTACAGGTTCTGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000094623    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_145363.1-296s1c1
Sequence:CCGGAGGGAGCAACTGTGTCAAATACTCGAGTATTTGACACAGTTGCTCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000094621    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_145363.1-161s1c1
Sequence:CCGGCAGTCCACCTACCGCAAATATCTCGAGATATTTGCGGTAGGTGGACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_145363
VALIDATED
TSPAN10 MISSION shRNA shRNA Plasmid DNA
tetraspanin 10
Mouse
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000382400    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145363.1-644s21c1
Sequence:GTACCGGTGCAGCCATCATTCACTACTGCTCGAGCAGTAGTGAATGATGGCTGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000382338    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145363.1-297s21c1
Sequence:GTACCGGGGGAGCAACTGTGTCAAATATCTCGAGATATTTGACACAGTTGCTCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000380639    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145363.1-502s21c1
Sequence:GTACCGGTGGGTGCTTTCTGTGAGAATACTCGAGTATTCTCACAGAAAGCACCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000381151    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145363.1-191s21c1
Sequence:GTACCGGAGCACCCTGGGAGAATCAGAACTCGAGTTCTGATTCTCCCAGGGTGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000381465    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145363.1-1201s21c1
Sequence:GTACCGGCTTTGCTACAACTGGGATATCCTCGAGGATATCCCAGTTGTAGCAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000380033    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145363.1-1252s21c1
Sequence:GTACCGGTGCTGCTCTAATCTCACAATTCTCGAGAATTGTGAGATTAGAGCAGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000381739    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145363.1-1428s21c1
Sequence:GTACCGGTGATCTATCTCACGCTGACTACTCGAGTAGTCAGCGTGAGATAGATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000094619    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145363.1-1253s1c1
Sequence:CCGGGCTGCTCTAATCTCACAATTTCTCGAGAAATTGTGAGATTAGAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000094620    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_145363.1-648s1c1
Sequence:CCGGGCCATCATTCACTACTGGGATCTCGAGATCCCAGTAGTGAATGATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000094622    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_145363.1-746s1c1
Sequence:CCGGGCAACAGAACCTGTACTTTAACTCGAGTTAAAGTACAGGTTCTGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000094623    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_145363.1-296s1c1
Sequence:CCGGAGGGAGCAACTGTGTCAAATACTCGAGTATTTGACACAGTTGCTCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000094621    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_145363.1-161s1c1
Sequence:CCGGCAGTCCACCTACCGCAAATATCTCGAGATATTTGCGGTAGGTGGACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_145363
VALIDATED
TSPAN10 MISSION shRNA Lentiviral Transduction Particles
tetraspanin 10
Mouse
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000382400    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145363.1-644s21c1
Sequence:GTACCGGTGCAGCCATCATTCACTACTGCTCGAGCAGTAGTGAATGATGGCTGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000382338    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145363.1-297s21c1
Sequence:GTACCGGGGGAGCAACTGTGTCAAATATCTCGAGATATTTGACACAGTTGCTCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000380639    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145363.1-502s21c1
Sequence:GTACCGGTGGGTGCTTTCTGTGAGAATACTCGAGTATTCTCACAGAAAGCACCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000381151    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145363.1-191s21c1
Sequence:GTACCGGAGCACCCTGGGAGAATCAGAACTCGAGTTCTGATTCTCCCAGGGTGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000381465    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145363.1-1201s21c1
Sequence:GTACCGGCTTTGCTACAACTGGGATATCCTCGAGGATATCCCAGTTGTAGCAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000380033    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145363.1-1252s21c1
Sequence:GTACCGGTGCTGCTCTAATCTCACAATTCTCGAGAATTGTGAGATTAGAGCAGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000381739    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145363.1-1428s21c1
Sequence:GTACCGGTGATCTATCTCACGCTGACTACTCGAGTAGTCAGCGTGAGATAGATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000094619    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145363.1-1253s1c1
Sequence:CCGGGCTGCTCTAATCTCACAATTTCTCGAGAAATTGTGAGATTAGAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000094620    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_145363.1-648s1c1
Sequence:CCGGGCCATCATTCACTACTGGGATCTCGAGATCCCAGTAGTGAATGATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000094622    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_145363.1-746s1c1
Sequence:CCGGGCAACAGAACCTGTACTTTAACTCGAGTTAAAGTACAGGTTCTGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000094623    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_145363.1-296s1c1
Sequence:CCGGAGGGAGCAACTGTGTCAAATACTCGAGTATTTGACACAGTTGCTCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000094621    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_145363.1-161s1c1
Sequence:CCGGCAGTCCACCTACCGCAAATATCTCGAGATATTTGCGGTAGGTGGACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_031945
TSPAN10 MISSION shRNA Bacterial Glycerol Stock
tetraspanin 10
Human
19 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000380873    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_031945.3-1397s21c1
Sequence:GTACCGGGAAATCCTGAAGCTGACCCTCCTCGAGGAGGGTCAGCTTCAGGATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000381372    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031945.3-897s21c1
Sequence:GTACCGGAGCTCAGAGAGTGGTGTACCTCTCGAGAGGTACACCACTCTCTGAGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000381469    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031945.3-314s21c1
Sequence:GTACCGGGCGTCAAGTATCTGATCTTCCCTCGAGGGAAGATCAGATACTTGACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000381564    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031945.3-752s21c1
Sequence:GTACCGGGGCAGCAGAACCTGTACTTTACTCGAGTAAAGTACAGGTTCTGCTGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000381593    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031945.3-835s21c1
Sequence:GTACCGGGAAGATGGAGCCTCTGTCAACCTCGAGGTTGACAGAGGCTCCATCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000381700    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031945.3-116s21c1
Sequence:GTACCGGTACTGTCCCAGGAAACTGCAGCTCGAGCTGCAGTTTCCTGGGACAGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000379755    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031945.3-761s21c1
Sequence:GTACCGGACCTGTACTTTAACTGCAGCTCTCGAGAGCTGCAGTTAAAGTACAGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000380182    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031945.3-406s21c1
Sequence:GTACCGGGGGTCTCTGGGAAGTGATCTGCTCGAGCAGATCACTTCCCAGAGACCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000381896    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_031945.3-1288s21c1
Sequence:GTACCGGACCTACCCAGCTCGCTCACTTCTCGAGAAGTGAGCGAGCTGGGTAGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000382132    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031945.3-242s21c1
Sequence:GTACCGGAGACCAAGCACCAGGCCTTGACTCGAGTCAAGGCCTGGTGCTTGGTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000382189    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031945.3-521s21c1
Sequence:GTACCGGGTGAGAACACCTGCCTGTTACCTCGAGGTAACAGGCAGGTGTTCTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000156083    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031945.2-298s1c1
Sequence:CCGGCAGCTGCGTCAAGTATCTGATCTCGAGATCAGATACTTGACGCAGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000154669    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031945.2-300s1c1
Sequence:CCGGGCTGCGTCAAGTATCTGATCTCTCGAGAGATCAGATACTTGACGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000152534    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031945.2-305s1c1
Sequence:CCGGGTCAAGTATCTGATCTTCCTCCTCGAGGAGGAAGATCAGATACTTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000152952    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031945.2-310s1c1
Sequence:CCGGGTATCTGATCTTCCTCTCCAACTCGAGTTGGAGAGGAAGATCAGATACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000153409    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031945.2-745s1c1
Sequence:CCGGGCAGAACCTGTACTTTAACTGCTCGAGCAGTTAAAGTACAGGTTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000153474    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031945.2-307s1c1
Sequence:CCGGCAAGTATCTGATCTTCCTCTCCTCGAGGAGAGGAAGATCAGATACTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000153523    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031945.2-304s1c1
Sequence:CCGGCGTCAAGTATCTGATCTTCCTCTCGAGAGGAAGATCAGATACTTGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000153580    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031945.2-748s1c1
Sequence:CCGGGAACCTGTACTTTAACTGCAGCTCGAGCTGCAGTTAAAGTACAGGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_031945
TSPAN10 MISSION shRNA shRNA Plasmid DNA
tetraspanin 10
Human
19 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000380873    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_031945.3-1397s21c1
Sequence:GTACCGGGAAATCCTGAAGCTGACCCTCCTCGAGGAGGGTCAGCTTCAGGATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000381372    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031945.3-897s21c1
Sequence:GTACCGGAGCTCAGAGAGTGGTGTACCTCTCGAGAGGTACACCACTCTCTGAGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000381469    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031945.3-314s21c1
Sequence:GTACCGGGCGTCAAGTATCTGATCTTCCCTCGAGGGAAGATCAGATACTTGACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000381564    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031945.3-752s21c1
Sequence:GTACCGGGGCAGCAGAACCTGTACTTTACTCGAGTAAAGTACAGGTTCTGCTGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000381593    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031945.3-835s21c1
Sequence:GTACCGGGAAGATGGAGCCTCTGTCAACCTCGAGGTTGACAGAGGCTCCATCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000381700    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031945.3-116s21c1
Sequence:GTACCGGTACTGTCCCAGGAAACTGCAGCTCGAGCTGCAGTTTCCTGGGACAGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000379755    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031945.3-761s21c1
Sequence:GTACCGGACCTGTACTTTAACTGCAGCTCTCGAGAGCTGCAGTTAAAGTACAGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000380182    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031945.3-406s21c1
Sequence:GTACCGGGGGTCTCTGGGAAGTGATCTGCTCGAGCAGATCACTTCCCAGAGACCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000381896    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_031945.3-1288s21c1
Sequence:GTACCGGACCTACCCAGCTCGCTCACTTCTCGAGAAGTGAGCGAGCTGGGTAGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000382132    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031945.3-242s21c1
Sequence:GTACCGGAGACCAAGCACCAGGCCTTGACTCGAGTCAAGGCCTGGTGCTTGGTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000382189    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031945.3-521s21c1
Sequence:GTACCGGGTGAGAACACCTGCCTGTTACCTCGAGGTAACAGGCAGGTGTTCTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000156083    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031945.2-298s1c1
Sequence:CCGGCAGCTGCGTCAAGTATCTGATCTCGAGATCAGATACTTGACGCAGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000154669    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031945.2-300s1c1
Sequence:CCGGGCTGCGTCAAGTATCTGATCTCTCGAGAGATCAGATACTTGACGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000152534    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031945.2-305s1c1
Sequence:CCGGGTCAAGTATCTGATCTTCCTCCTCGAGGAGGAAGATCAGATACTTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000152952    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031945.2-310s1c1
Sequence:CCGGGTATCTGATCTTCCTCTCCAACTCGAGTTGGAGAGGAAGATCAGATACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000153409    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031945.2-745s1c1
Sequence:CCGGGCAGAACCTGTACTTTAACTGCTCGAGCAGTTAAAGTACAGGTTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000153474    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031945.2-307s1c1
Sequence:CCGGCAAGTATCTGATCTTCCTCTCCTCGAGGAGAGGAAGATCAGATACTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000153523    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031945.2-304s1c1
Sequence:CCGGCGTCAAGTATCTGATCTTCCTCTCGAGAGGAAGATCAGATACTTGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000153580    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031945.2-748s1c1
Sequence:CCGGGAACCTGTACTTTAACTGCAGCTCGAGCTGCAGTTAAAGTACAGGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_031945
TSPAN10 MISSION shRNA Lentiviral Transduction Particles
tetraspanin 10
Human
19 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000380873    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_031945.3-1397s21c1
Sequence:GTACCGGGAAATCCTGAAGCTGACCCTCCTCGAGGAGGGTCAGCTTCAGGATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000381372    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031945.3-897s21c1
Sequence:GTACCGGAGCTCAGAGAGTGGTGTACCTCTCGAGAGGTACACCACTCTCTGAGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000381469    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031945.3-314s21c1
Sequence:GTACCGGGCGTCAAGTATCTGATCTTCCCTCGAGGGAAGATCAGATACTTGACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000381564    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031945.3-752s21c1
Sequence:GTACCGGGGCAGCAGAACCTGTACTTTACTCGAGTAAAGTACAGGTTCTGCTGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000381593    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031945.3-835s21c1
Sequence:GTACCGGGAAGATGGAGCCTCTGTCAACCTCGAGGTTGACAGAGGCTCCATCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000381700    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031945.3-116s21c1
Sequence:GTACCGGTACTGTCCCAGGAAACTGCAGCTCGAGCTGCAGTTTCCTGGGACAGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000379755    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031945.3-761s21c1
Sequence:GTACCGGACCTGTACTTTAACTGCAGCTCTCGAGAGCTGCAGTTAAAGTACAGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000380182    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031945.3-406s21c1
Sequence:GTACCGGGGGTCTCTGGGAAGTGATCTGCTCGAGCAGATCACTTCCCAGAGACCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000381896    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_031945.3-1288s21c1
Sequence:GTACCGGACCTACCCAGCTCGCTCACTTCTCGAGAAGTGAGCGAGCTGGGTAGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000382132    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031945.3-242s21c1
Sequence:GTACCGGAGACCAAGCACCAGGCCTTGACTCGAGTCAAGGCCTGGTGCTTGGTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000382189    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031945.3-521s21c1
Sequence:GTACCGGGTGAGAACACCTGCCTGTTACCTCGAGGTAACAGGCAGGTGTTCTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000156083    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031945.2-298s1c1
Sequence:CCGGCAGCTGCGTCAAGTATCTGATCTCGAGATCAGATACTTGACGCAGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000154669    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031945.2-300s1c1
Sequence:CCGGGCTGCGTCAAGTATCTGATCTCTCGAGAGATCAGATACTTGACGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000152534    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031945.2-305s1c1
Sequence:CCGGGTCAAGTATCTGATCTTCCTCCTCGAGGAGGAAGATCAGATACTTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000152952    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031945.2-310s1c1
Sequence:CCGGGTATCTGATCTTCCTCTCCAACTCGAGTTGGAGAGGAAGATCAGATACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000153409    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031945.2-745s1c1
Sequence:CCGGGCAGAACCTGTACTTTAACTGCTCGAGCAGTTAAAGTACAGGTTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000153474    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_031945.2-307s1c1
Sequence:CCGGCAAGTATCTGATCTTCCTCTCCTCGAGGAGAGGAAGATCAGATACTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000153523    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031945.2-304s1c1
Sequence:CCGGCGTCAAGTATCTGATCTTCCTCTCGAGAGGAAGATCAGATACTTGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000153580    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031945.2-748s1c1
Sequence:CCGGGAACCTGTACTTTAACTGCAGCTCGAGCTGCAGTTAAAGTACAGGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks