EMAIL THIS PAGE TO A FRIEND

TSPAN11

tetraspanin 11

Synonyms: VSSW1971
UniProtKB ID: A1L157, A1L158, B2RUX6
Gene ID:
Mouse(68498) tetraspanin 11
Rat(312727) tetraspanin 11
Zebrafish(564029) tetraspanin 11
dog(611819) tetraspanin-11-like
cow(616660) tetraspanin 11
72 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA066789 Anti-TSPAN11 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody New human
immunofluorescence, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_026743 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026743 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026743 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001080509 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001080509 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001080509 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001080509 Rosetta Predictions human pricing
XM_497334 Rosetta Predictions human pricing
NM_001024262 Rosetta Predictions rat pricing
NM_026743 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001080509 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00315527 predicted 1089
2 SASI_Hs02_00315528 predicted 555
3 SASI_Hs02_00315529 predicted 990
4 SASI_Hs02_00315530 predicted 600
5 SASI_Hs02_00315531 predicted 292
6 SASI_Hs02_00315532 predicted 1216
7 SASI_Hs02_00315533 predicted 607
8 SASI_Hs02_00315534 predicted 809
9 SASI_Hs02_00315535 predicted 997
10 SASI_Hs02_00315536 predicted 1099
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_497334 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00261423 predicted 515
2 SASI_Hs01_00261424 predicted 447
3 SASI_Hs01_00261425 predicted 256
4 SASI_Hs01_00261426 predicted 512
5 SASI_Hs01_00261427 predicted 202
6 SASI_Hs01_00261428 predicted 558
7 SASI_Hs01_00261429 predicted 436
8 SASI_Hs01_00261430 predicted 316
9 SASI_Hs01_00261431 predicted 529
10 SASI_Hs01_00261432 predicted 205
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001024262 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00084218 predicted 487
2 SASI_Rn02_00202427 predicted 227
3 SASI_Rn01_00084219 predicted 1026
4 SASI_Rn01_00084220 predicted 629
5 SASI_Rn01_00084221 predicted 1079
6 SASI_Rn02_00202428 predicted 410
7 SASI_Rn01_00084222 predicted 914
8 SASI_Rn01_00084224 predicted 1290
9 SASI_Rn01_00084226 predicted 475
10 SASI_Rn02_00202429 predicted 387
11 SASI_Rn01_00084223 predicted 1114
12 SASI_Rn01_00084225 predicted 1194
13 SASI_Rn01_00084227 predicted 260
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026743 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00023045 predicted 713
2 SASI_Mm01_00023046 predicted 928
3 SASI_Mm01_00023047 predicted 873
4 SASI_Mm01_00023048 predicted 1407
5 SASI_Mm01_00023049 predicted 1463
6 SASI_Mm01_00023050 predicted 620
7 SASI_Mm01_00023051 predicted 1142
8 SASI_Mm01_00023052 predicted 764
9 SASI_Mm01_00023053 predicted 858
10 SASI_Mm01_00023054 predicted 1473
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026743
TSPAN11 MISSION shRNA Bacterial Glycerol Stock
tetraspanin 11
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000094434    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026743.2-3007s1c1
Sequence:CCGGCCAGAGTATTTCTACCTATTTCTCGAGAAATAGGTAGAAATACTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000094436    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026743.2-860s1c1
Sequence:CCGGCCCTCCAACATCTACAAGGTACTCGAGTACCTTGTAGATGTTGGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000094437    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026743.2-723s1c1
Sequence:CCGGACTTCAAATGCTGTGGCAGTACTCGAGTACTGCCACAGCATTTGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000094435    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026743.2-770s1c1
Sequence:CCGGGCGTACATCTTGTCTCAGGAACTCGAGTTCCTGAGACAAGATGTACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000094438    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026743.2-313s1c1
Sequence:CCGGCCTGAAGTACCTGCTCTTCATCTCGAGATGAAGAGCAGGTACTTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026743
TSPAN11 MISSION shRNA shRNA Plasmid DNA
tetraspanin 11
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000094434    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026743.2-3007s1c1
Sequence:CCGGCCAGAGTATTTCTACCTATTTCTCGAGAAATAGGTAGAAATACTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000094436    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026743.2-860s1c1
Sequence:CCGGCCCTCCAACATCTACAAGGTACTCGAGTACCTTGTAGATGTTGGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000094437    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026743.2-723s1c1
Sequence:CCGGACTTCAAATGCTGTGGCAGTACTCGAGTACTGCCACAGCATTTGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000094435    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026743.2-770s1c1
Sequence:CCGGGCGTACATCTTGTCTCAGGAACTCGAGTTCCTGAGACAAGATGTACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000094438    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026743.2-313s1c1
Sequence:CCGGCCTGAAGTACCTGCTCTTCATCTCGAGATGAAGAGCAGGTACTTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026743
TSPAN11 MISSION shRNA Lentiviral Transduction Particles
tetraspanin 11
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000094434    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026743.2-3007s1c1
Sequence:CCGGCCAGAGTATTTCTACCTATTTCTCGAGAAATAGGTAGAAATACTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000094436    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026743.2-860s1c1
Sequence:CCGGCCCTCCAACATCTACAAGGTACTCGAGTACCTTGTAGATGTTGGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000094437    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026743.2-723s1c1
Sequence:CCGGACTTCAAATGCTGTGGCAGTACTCGAGTACTGCCACAGCATTTGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000094435    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026743.2-770s1c1
Sequence:CCGGGCGTACATCTTGTCTCAGGAACTCGAGTTCCTGAGACAAGATGTACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000094438    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026743.2-313s1c1
Sequence:CCGGCCTGAAGTACCTGCTCTTCATCTCGAGATGAAGAGCAGGTACTTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001080509
TSPAN11 MISSION shRNA Bacterial Glycerol Stock
tetraspanin 11
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000265535    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080509.2-292s21c1
Sequence:CCGGCCGCCTACATCCTCATCTTTGCTCGAGCAAAGATGAGGATGTAGGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000254477    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080509.2-149s21c1
Sequence:CCGGGATCATCTACTTGAAGTATTTCTCGAGAAATACTTCAAGTAGATGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000254478    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080509.2-436s21c1
Sequence:CCGGGAGTCCTGGCCCATGTGTATTCTCGAGAATACACATGGGCCAGGACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000254476    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001080509.2-4673s21c1
Sequence:CCGGTATAGTGACCAAGCGTCTAAACTCGAGTTTAGACGCTTGGTCACTATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000254701    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080509.2-553s21c1
Sequence:CCGGACCGACTCCAGCAGGATTTCACTCGAGTGAAATCCTGCTGGAGTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001080509
TSPAN11 MISSION shRNA shRNA Plasmid DNA
tetraspanin 11
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000265535    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080509.2-292s21c1
Sequence:CCGGCCGCCTACATCCTCATCTTTGCTCGAGCAAAGATGAGGATGTAGGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000254477    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080509.2-149s21c1
Sequence:CCGGGATCATCTACTTGAAGTATTTCTCGAGAAATACTTCAAGTAGATGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000254478    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080509.2-436s21c1
Sequence:CCGGGAGTCCTGGCCCATGTGTATTCTCGAGAATACACATGGGCCAGGACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000254476    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001080509.2-4673s21c1
Sequence:CCGGTATAGTGACCAAGCGTCTAAACTCGAGTTTAGACGCTTGGTCACTATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000254701    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080509.2-553s21c1
Sequence:CCGGACCGACTCCAGCAGGATTTCACTCGAGTGAAATCCTGCTGGAGTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001080509
TSPAN11 MISSION shRNA Lentiviral Transduction Particles
tetraspanin 11
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000265535    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080509.2-292s21c1
Sequence:CCGGCCGCCTACATCCTCATCTTTGCTCGAGCAAAGATGAGGATGTAGGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000254477    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080509.2-149s21c1
Sequence:CCGGGATCATCTACTTGAAGTATTTCTCGAGAAATACTTCAAGTAGATGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000254478    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080509.2-436s21c1
Sequence:CCGGGAGTCCTGGCCCATGTGTATTCTCGAGAATACACATGGGCCAGGACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000254476    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001080509.2-4673s21c1
Sequence:CCGGTATAGTGACCAAGCGTCTAAACTCGAGTTTAGACGCTTGGTCACTATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000254701    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080509.2-553s21c1
Sequence:CCGGACCGACTCCAGCAGGATTTCACTCGAGTGAAATCCTGCTGGAGTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks