EMAIL THIS PAGE TO A FRIEND

TSPAN12

tetraspanin 12

Synonyms: EVR5 NET-2 NET2 TM4SF12
UniProtKB ID: O95859, A4D0V8, B4DRG6, Q549U9, Q8N5Y0
Gene ID:
Human(23554) Summary: The protein encoded by this gene is a member of the transmembrane 4 superfamily, also known as the tetraspanin family. Most of these members are cell-surface proteins that are characterized by the presence of four hydrophobic domains. The proteins mediate signal transduction events that play a role in the regulation of cell development, activation, growth and motility. [provided by RefSeq, Jul 2008]
Mouse(269831) tetraspanin 12
Rat(362326) tetraspanin 12
naked mole-rat(101711949) tetraspanin 12
cow(613639) tetraspanin 12
sheep(101102475) tetraspanin 12
Zebrafish(394127) tetraspanin 12
chicken(417763) tetraspanin 12
dog(612262) tetraspanin 12
domestic cat(101089340) tetraspanin 12
104 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
AV46887 Anti-TSPAN12 antibody produced in rabbit affinity isolated antibody canine, rat, guinea pig, rabbit, bovine, zebrafish, horse, mouse, human
western blot pricing
SAB2103828 Anti-TSPAN12 antibody produced in rabbit affinity isolated antibody human, mouse, guinea pig, rat, rabbit, zebrafish, horse, canine, bovine
western blot pricing
HPA058244 Anti-TSPAN12 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_173007 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_173007 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_173007 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_012338 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_012338 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_012338 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_012338 Rosetta Predictions human pricing
NM_001015026 Rosetta Predictions rat pricing
NM_173007 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012338 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00236332 predicted 724
2 SASI_Hs01_00236334 predicted 768
3 SASI_Hs01_00236335 predicted 833
4 SASI_Hs01_00236336 predicted 483
5 SASI_Hs01_00236337 predicted 1256
6 SASI_Hs01_00236338 predicted 804
7 SASI_Hs01_00236339 predicted 610
8 SASI_Hs02_00344137 predicted 1204
9 SASI_Hs01_00236340 predicted 568
10 SASI_Hs02_00344138 predicted 605
11 SASI_Hs01_00236331 predicted 1249
12 SASI_Hs01_00236333 predicted 961
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001015026 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00202113 predicted 1269
2 SASI_Rn02_00202114 predicted 1194
3 SASI_Rn02_00202115 predicted 1270
4 SASI_Rn02_00202116 predicted 698
5 SASI_Rn02_00202117 predicted 730
6 SASI_Rn02_00202118 predicted 1069
7 SASI_Rn02_00202119 predicted 1238
8 SASI_Rn02_00202120 predicted 677
9 SASI_Rn02_00202121 predicted 745
10 SASI_Rn02_00202122 predicted 537
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_173007 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00181784 predicted 1107
2 SASI_Mm01_00181785 predicted 1186
3 SASI_Mm01_00181786 predicted 1243
4 SASI_Mm01_00181787 predicted 620
5 SASI_Mm01_00181788 predicted 667
6 SASI_Mm01_00181789 predicted 573
7 SASI_Mm01_00181790 predicted 690
8 SASI_Mm01_00181792 predicted 757
9 SASI_Mm01_00181791 predicted 1206
10 SASI_Mm01_00181793 predicted 485
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_173007
VALIDATED
TSPAN12 MISSION shRNA Bacterial Glycerol Stock
tetraspanin 12
Mouse
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000382046    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_173007.3-437s21c1
Sequence:GTACCGGGGATGAGGGACTACCTGAATACTCGAGTATTCAGGTAGTCCCTCATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000351326    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_173007.3-1138s21c2
Sequence:CCGGTCTCAGCACTTGTCATGTCATCTCGAGATGACATGACAAGTGCTGAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000381670    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_173007.3-746s21c1
Sequence:GTACCGGATTACGGCTTACCGAGGTATACTCGAGTATACCTCGGTAAGCCGTAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000351598    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_173007.3-699s21c2
Sequence:CCGGGCCAGTACAGTGGTCAGATATCTCGAGATATCTGACCACTGTACTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000351634    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_173007.3-2073s21c3
Sequence:CCGGCGGAAGTATTAACTACAGAATCTCGAGATTCTGTAGTTAATACTTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000351633    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173007.3-1177s21c3
Sequence:CCGGCCAAGTCTTTCAAGGATCTTTCTCGAGAAAGATCCTTGAAAGACTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000381411    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_173007.3-676s21c1
Sequence:GTACCGGACATACGAGCAGGAGGTTATGCTCGAGCATAACCTCCTGCTCGTATGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000127024    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_173007.1-2074s1c1
Sequence:CCGGCGGAAGTATTAACTACAGAATCTCGAGATTCTGTAGTTAATACTTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000127028    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_173007.1-1139s1c1
Sequence:CCGGTCTCAGCACTTGTCATGTCATCTCGAGATGACATGACAAGTGCTGAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000127027    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173007.1-552s1c1
Sequence:CCGGGCTTCCTTATCATCGTGGGAACTCGAGTTCCCACGATGATAAGGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000127025    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173007.1-700s1c1
Sequence:CCGGGCCAGTACAGTGGTCAGATATCTCGAGATATCTGACCACTGTACTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000127026    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_173007.1-1178s1c1
Sequence:CCGGCCAAGTCTTTCAAGGATCTTTCTCGAGAAAGATCCTTGAAAGACTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_173007
VALIDATED
TSPAN12 MISSION shRNA shRNA Plasmid DNA
tetraspanin 12
Mouse
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000382046    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_173007.3-437s21c1
Sequence:GTACCGGGGATGAGGGACTACCTGAATACTCGAGTATTCAGGTAGTCCCTCATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000351326    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_173007.3-1138s21c2
Sequence:CCGGTCTCAGCACTTGTCATGTCATCTCGAGATGACATGACAAGTGCTGAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000381670    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_173007.3-746s21c1
Sequence:GTACCGGATTACGGCTTACCGAGGTATACTCGAGTATACCTCGGTAAGCCGTAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000351598    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_173007.3-699s21c2
Sequence:CCGGGCCAGTACAGTGGTCAGATATCTCGAGATATCTGACCACTGTACTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000351634    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_173007.3-2073s21c3
Sequence:CCGGCGGAAGTATTAACTACAGAATCTCGAGATTCTGTAGTTAATACTTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000351633    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173007.3-1177s21c3
Sequence:CCGGCCAAGTCTTTCAAGGATCTTTCTCGAGAAAGATCCTTGAAAGACTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000381411    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_173007.3-676s21c1
Sequence:GTACCGGACATACGAGCAGGAGGTTATGCTCGAGCATAACCTCCTGCTCGTATGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000127024    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_173007.1-2074s1c1
Sequence:CCGGCGGAAGTATTAACTACAGAATCTCGAGATTCTGTAGTTAATACTTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000127028    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_173007.1-1139s1c1
Sequence:CCGGTCTCAGCACTTGTCATGTCATCTCGAGATGACATGACAAGTGCTGAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000127027    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173007.1-552s1c1
Sequence:CCGGGCTTCCTTATCATCGTGGGAACTCGAGTTCCCACGATGATAAGGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000127025    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173007.1-700s1c1
Sequence:CCGGGCCAGTACAGTGGTCAGATATCTCGAGATATCTGACCACTGTACTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000127026    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_173007.1-1178s1c1
Sequence:CCGGCCAAGTCTTTCAAGGATCTTTCTCGAGAAAGATCCTTGAAAGACTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_173007
VALIDATED
TSPAN12 MISSION shRNA Lentiviral Transduction Particles
tetraspanin 12
Mouse
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000382046    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_173007.3-437s21c1
Sequence:GTACCGGGGATGAGGGACTACCTGAATACTCGAGTATTCAGGTAGTCCCTCATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000351326    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_173007.3-1138s21c2
Sequence:CCGGTCTCAGCACTTGTCATGTCATCTCGAGATGACATGACAAGTGCTGAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000381670    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_173007.3-746s21c1
Sequence:GTACCGGATTACGGCTTACCGAGGTATACTCGAGTATACCTCGGTAAGCCGTAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000351598    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_173007.3-699s21c2
Sequence:CCGGGCCAGTACAGTGGTCAGATATCTCGAGATATCTGACCACTGTACTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000351634    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_173007.3-2073s21c3
Sequence:CCGGCGGAAGTATTAACTACAGAATCTCGAGATTCTGTAGTTAATACTTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000351633    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173007.3-1177s21c3
Sequence:CCGGCCAAGTCTTTCAAGGATCTTTCTCGAGAAAGATCCTTGAAAGACTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000381411    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_173007.3-676s21c1
Sequence:GTACCGGACATACGAGCAGGAGGTTATGCTCGAGCATAACCTCCTGCTCGTATGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000127024    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_173007.1-2074s1c1
Sequence:CCGGCGGAAGTATTAACTACAGAATCTCGAGATTCTGTAGTTAATACTTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000127028    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_173007.1-1139s1c1
Sequence:CCGGTCTCAGCACTTGTCATGTCATCTCGAGATGACATGACAAGTGCTGAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000127027    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173007.1-552s1c1
Sequence:CCGGGCTTCCTTATCATCGTGGGAACTCGAGTTCCCACGATGATAAGGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000127025    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173007.1-700s1c1
Sequence:CCGGGCCAGTACAGTGGTCAGATATCTCGAGATATCTGACCACTGTACTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000127026    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_173007.1-1178s1c1
Sequence:CCGGCCAAGTCTTTCAAGGATCTTTCTCGAGAAAGATCCTTGAAAGACTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_012338
TSPAN12 MISSION shRNA Bacterial Glycerol Stock
tetraspanin 12
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000379849    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012338.3-1631s21c1
Sequence:GTACCGGAGCCATAGTAAAGGTTGATTTCTCGAGAAATCAACCTTTACTATGGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000379898    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012338.3-728s21c1
Sequence:GTACCGGACTTATGGTTCCAGTACAATGCTCGAGCATTGTACTGGAACCATAAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000162790    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_012338.3-564s1c1
Sequence:CCGGCATCCGGTCATGATTGCTGTTCTCGAGAACAGCAATCATGACCGGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000160369    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012338.3-1225s1c1
Sequence:CCGGCAAGAATCTTTGAACACACATCTCGAGATGTGTGTTCAAAGATTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000158467    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_012338.3-1733s1c1
Sequence:CCGGCGATCTATTCTTCTGATGCTACTCGAGTAGCATCAGAAGAATAGATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000158849    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_012338.3-1844s1c1
Sequence:CCGGGCAAGCTAACACATTGTCTTACTCGAGTAAGACAATGTGTTAGCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000159397    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_012338.3-476s1c1
Sequence:CCGGGATGAGGGACTACCTAAATAACTCGAGTTATTTAGGTAGTCCCTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000159520    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012338.3-773s1c1
Sequence:CCGGCAGGATGACAAATTATGGATTCTCGAGAATCCATAATTTGTCATCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000159671    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012338.3-1154s1c1
Sequence:CCGGGATGTCCTTGAAGAATGACAACTCGAGTTGTCATTCTTCAAGGACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000160529    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_012338.3-662s1c1
Sequence:CCGGCTTTGGAAGTTTGCTTGTCATCTCGAGATGACAAGCAAACTTCCAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000162444    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_012338.3-723s1c1
Sequence:CCGGCAGGAACTTATGGTTCCAGTACTCGAGTACTGGAACCATAAGTTCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_012338
TSPAN12 MISSION shRNA shRNA Plasmid DNA
tetraspanin 12
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000379849    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012338.3-1631s21c1
Sequence:GTACCGGAGCCATAGTAAAGGTTGATTTCTCGAGAAATCAACCTTTACTATGGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000379898    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012338.3-728s21c1
Sequence:GTACCGGACTTATGGTTCCAGTACAATGCTCGAGCATTGTACTGGAACCATAAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000162790    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_012338.3-564s1c1
Sequence:CCGGCATCCGGTCATGATTGCTGTTCTCGAGAACAGCAATCATGACCGGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000160369    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012338.3-1225s1c1
Sequence:CCGGCAAGAATCTTTGAACACACATCTCGAGATGTGTGTTCAAAGATTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000158467    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_012338.3-1733s1c1
Sequence:CCGGCGATCTATTCTTCTGATGCTACTCGAGTAGCATCAGAAGAATAGATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000158849    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_012338.3-1844s1c1
Sequence:CCGGGCAAGCTAACACATTGTCTTACTCGAGTAAGACAATGTGTTAGCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000159397    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_012338.3-476s1c1
Sequence:CCGGGATGAGGGACTACCTAAATAACTCGAGTTATTTAGGTAGTCCCTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000159520    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012338.3-773s1c1
Sequence:CCGGCAGGATGACAAATTATGGATTCTCGAGAATCCATAATTTGTCATCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000159671    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012338.3-1154s1c1
Sequence:CCGGGATGTCCTTGAAGAATGACAACTCGAGTTGTCATTCTTCAAGGACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000160529    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_012338.3-662s1c1
Sequence:CCGGCTTTGGAAGTTTGCTTGTCATCTCGAGATGACAAGCAAACTTCCAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000162444    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_012338.3-723s1c1
Sequence:CCGGCAGGAACTTATGGTTCCAGTACTCGAGTACTGGAACCATAAGTTCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_012338
TSPAN12 MISSION shRNA Lentiviral Transduction Particles
tetraspanin 12
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000379849    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012338.3-1631s21c1
Sequence:GTACCGGAGCCATAGTAAAGGTTGATTTCTCGAGAAATCAACCTTTACTATGGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000379898    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012338.3-728s21c1
Sequence:GTACCGGACTTATGGTTCCAGTACAATGCTCGAGCATTGTACTGGAACCATAAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000162790    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_012338.3-564s1c1
Sequence:CCGGCATCCGGTCATGATTGCTGTTCTCGAGAACAGCAATCATGACCGGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000160369    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012338.3-1225s1c1
Sequence:CCGGCAAGAATCTTTGAACACACATCTCGAGATGTGTGTTCAAAGATTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000158467    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_012338.3-1733s1c1
Sequence:CCGGCGATCTATTCTTCTGATGCTACTCGAGTAGCATCAGAAGAATAGATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000158849    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_012338.3-1844s1c1
Sequence:CCGGGCAAGCTAACACATTGTCTTACTCGAGTAAGACAATGTGTTAGCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000159397    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_012338.3-476s1c1
Sequence:CCGGGATGAGGGACTACCTAAATAACTCGAGTTATTTAGGTAGTCCCTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000159520    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012338.3-773s1c1
Sequence:CCGGCAGGATGACAAATTATGGATTCTCGAGAATCCATAATTTGTCATCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000159671    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012338.3-1154s1c1
Sequence:CCGGGATGTCCTTGAAGAATGACAACTCGAGTTGTCATTCTTCAAGGACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000160529    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_012338.3-662s1c1
Sequence:CCGGCTTTGGAAGTTTGCTTGTCATCTCGAGATGACAAGCAAACTTCCAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000162444    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_012338.3-723s1c1
Sequence:CCGGCAGGAACTTATGGTTCCAGTACTCGAGTACTGGAACCATAAGTTCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks