EMAIL THIS PAGE TO A FRIEND

TSPAN13

tetraspanin 13

Synonyms: NET-6 NET6 TM4SF13
UniProtKB ID: O95857
Gene ID:
Human(27075) Summary: The protein encoded by this gene is a member of the transmembrane 4 superfamily, also known as the tetraspanin family. Most of these members are cell-surface proteins that are characterized by the presence of four hydrophobic domains. The proteins mediate signal transduction events that play a role in the regulation of cell development, activation, growth and motility. [provided by RefSeq, Jul 2008]
Mouse(66109) tetraspanin 13
Rat(366602) tetraspanin 13
chicken(420595) tetraspanin 13
dog(482332) tetraspanin 13
domestic cat(101084435) tetraspanin 13
cow(526460) tetraspanin 13
sheep(101105070) tetraspanin 13
naked mole-rat(101710386) tetraspanin 13
111 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB4301656 Anti-TSPAN13 affinity isolated antibody mouse, rat, human
immunohistochemistry, western blot pricing
HPA007426 Anti-TSPAN13 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_025359 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_025359 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_025359 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_014399 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014399 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014399 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU155851 MISSION® esiRNA esiRNA human TSPAN13 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014399 Rosetta Predictions human pricing
NM_001013244 Rosetta Predictions rat pricing
NM_025359 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014399 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00198199 predicted 992
2 SASI_Hs01_00198200 predicted 861
3 SASI_Hs01_00198201 predicted 940
4 SASI_Hs01_00198202 predicted 962
5 SASI_Hs02_00345586 predicted 966
6 SASI_Hs01_00198204 predicted 965
7 SASI_Hs01_00198205 predicted 427
8 SASI_Hs01_00198206 predicted 865
9 SASI_Hs01_00198207 predicted 444
10 SASI_Hs02_00345587 predicted 1088
11 SASI_Hs01_00198203 predicted 1077
12 SASI_Hs01_00198208 predicted 493
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001013244 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00201068 predicted 950
2 SASI_Rn01_00078263 predicted 824
3 SASI_Rn01_00078264 predicted 511
4 SASI_Rn01_00078265 predicted 819
5 SASI_Rn01_00078266 predicted 204
6 SASI_Rn01_00078267 predicted 656
7 SASI_Rn01_00078268 predicted 554
8 SASI_Rn01_00078270 predicted 632
9 SASI_Rn01_00078271 predicted 425
10 SASI_Rn01_00078272 predicted 711
11 SASI_Rn01_00078269 predicted 883
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025359 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00328048 predicted 262
2 SASI_Mm02_00328049 predicted 580
3 SASI_Mm02_00328050 predicted 1272
4 SASI_Mm02_00328051 predicted 674
5 SASI_Mm02_00328052 predicted 530
6 SASI_Mm02_00328053 predicted 659
7 SASI_Mm02_00328054 predicted 1217
8 SASI_Mm02_00328055 predicted 1192
9 SASI_Mm02_00328056 predicted 1152
10 SASI_Mm02_00328057 predicted 638
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025359
VALIDATED
TSPAN13 MISSION shRNA Bacterial Glycerol Stock
tetraspanin 13
Mouse
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000120862    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_025359.2-1040s1c1
Sequence:CCGGCCGTGGCCTTTCTTAGCATTTCTCGAGAAATGCTAAGAAAGGCCACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000120863    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025359.2-520s1c1
Sequence:CCGGCGAAATGATATCCAGAGGAATCTCGAGATTCCTCTGGATATCATTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000120866    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025359.2-411s1c1
Sequence:CCGGCCTACTTGTATTTATTGTCCACTCGAGTGGACAATAAATACAAGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000120865    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025359.2-519s1c1
Sequence:CCGGTCGAAATGATATCCAGAGGAACTCGAGTTCCTCTGGATATCATTTCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000381652    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025359.3-235s21c1
Sequence:GTACCGGAGCCTGCTGCTCATTGGGATTCTCGAGAATCCCAATGAGCAGCAGGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000379922    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025359.3-556s21c1
Sequence:GTACCGGTTCCGGAGCTATAACCCAAATCTCGAGATTTGGGTTATAGCTCCGGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000380491    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025359.3-677s21c1
Sequence:GTACCGGGCATTGGTCTCTTCTTCAGTTCTCGAGAACTGAAGAAGAGACCAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000380743    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025359.3-768s21c1
Sequence:GTACCGGTGCTTTCCTTTGACGAGAAGACTCGAGTCTTCTCGTCAAAGGAAAGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000381446    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025359.3-704s21c1
Sequence:GTACCGGAGATCCTGGGTGTTTGGCTGACTCGAGTCAGCCAAACACCCAGGATCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000381588    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025359.3-446s21c1
Sequence:GTACCGGGTGCTTGTTTAGCTCTGAATCCTCGAGGATTCAGAGCTAAACAAGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000381600    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025359.3-506s21c1
Sequence:GTACCGGATACTGCAAGTGCTCGAAATGCTCGAGCATTTCGAGCACTTGCAGTATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025359
VALIDATED
TSPAN13 MISSION shRNA shRNA Plasmid DNA
tetraspanin 13
Mouse
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000120862    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_025359.2-1040s1c1
Sequence:CCGGCCGTGGCCTTTCTTAGCATTTCTCGAGAAATGCTAAGAAAGGCCACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000120863    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025359.2-520s1c1
Sequence:CCGGCGAAATGATATCCAGAGGAATCTCGAGATTCCTCTGGATATCATTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000120866    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025359.2-411s1c1
Sequence:CCGGCCTACTTGTATTTATTGTCCACTCGAGTGGACAATAAATACAAGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000120865    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025359.2-519s1c1
Sequence:CCGGTCGAAATGATATCCAGAGGAACTCGAGTTCCTCTGGATATCATTTCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000381652    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025359.3-235s21c1
Sequence:GTACCGGAGCCTGCTGCTCATTGGGATTCTCGAGAATCCCAATGAGCAGCAGGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000379922    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025359.3-556s21c1
Sequence:GTACCGGTTCCGGAGCTATAACCCAAATCTCGAGATTTGGGTTATAGCTCCGGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000380491    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025359.3-677s21c1
Sequence:GTACCGGGCATTGGTCTCTTCTTCAGTTCTCGAGAACTGAAGAAGAGACCAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000380743    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025359.3-768s21c1
Sequence:GTACCGGTGCTTTCCTTTGACGAGAAGACTCGAGTCTTCTCGTCAAAGGAAAGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000381446    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025359.3-704s21c1
Sequence:GTACCGGAGATCCTGGGTGTTTGGCTGACTCGAGTCAGCCAAACACCCAGGATCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000381588    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025359.3-446s21c1
Sequence:GTACCGGGTGCTTGTTTAGCTCTGAATCCTCGAGGATTCAGAGCTAAACAAGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000381600    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025359.3-506s21c1
Sequence:GTACCGGATACTGCAAGTGCTCGAAATGCTCGAGCATTTCGAGCACTTGCAGTATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025359
VALIDATED
TSPAN13 MISSION shRNA Lentiviral Transduction Particles
tetraspanin 13
Mouse
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000120862    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_025359.2-1040s1c1
Sequence:CCGGCCGTGGCCTTTCTTAGCATTTCTCGAGAAATGCTAAGAAAGGCCACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000120863    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025359.2-520s1c1
Sequence:CCGGCGAAATGATATCCAGAGGAATCTCGAGATTCCTCTGGATATCATTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000120866    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025359.2-411s1c1
Sequence:CCGGCCTACTTGTATTTATTGTCCACTCGAGTGGACAATAAATACAAGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000120865    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025359.2-519s1c1
Sequence:CCGGTCGAAATGATATCCAGAGGAACTCGAGTTCCTCTGGATATCATTTCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000381652    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025359.3-235s21c1
Sequence:GTACCGGAGCCTGCTGCTCATTGGGATTCTCGAGAATCCCAATGAGCAGCAGGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000379922    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025359.3-556s21c1
Sequence:GTACCGGTTCCGGAGCTATAACCCAAATCTCGAGATTTGGGTTATAGCTCCGGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000380491    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025359.3-677s21c1
Sequence:GTACCGGGCATTGGTCTCTTCTTCAGTTCTCGAGAACTGAAGAAGAGACCAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000380743    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025359.3-768s21c1
Sequence:GTACCGGTGCTTTCCTTTGACGAGAAGACTCGAGTCTTCTCGTCAAAGGAAAGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000381446    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025359.3-704s21c1
Sequence:GTACCGGAGATCCTGGGTGTTTGGCTGACTCGAGTCAGCCAAACACCCAGGATCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000381588    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025359.3-446s21c1
Sequence:GTACCGGGTGCTTGTTTAGCTCTGAATCCTCGAGGATTCAGAGCTAAACAAGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000381600    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025359.3-506s21c1
Sequence:GTACCGGATACTGCAAGTGCTCGAAATGCTCGAGCATTTCGAGCACTTGCAGTATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014399
VALIDATED
TSPAN13 MISSION shRNA Bacterial Glycerol Stock
tetraspanin 13
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000164054    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014399.2-613s1c1
Sequence:CCGGCAAATGACACCTGTCTGGCTACTCGAGTAGCCAGACAGGTGTCATTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000161337    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_014399.2-260s1c1
Sequence:CCGGGCTTTACACCTTGGTTAGTCTCTCGAGAGACTAACCAAGGTGTAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000160041    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014399.2-573s1c1
Sequence:CCGGCAGAGAAATCTAAACTGCTGTCTCGAGACAGCAGTTTAGATTTCTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000160162    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_014399.2-368s1c1
Sequence:CCGGCTTCTTGTTCCTGATTGCTTTCTCGAGAAAGCAATCAGGAACAAGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000160755    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014399.2-677s1c1
Sequence:CCGGCATAGGAGAATATGCTGGAGACTCGAGTCTCCAGCATATTCTCCTATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000161241    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_014399.2-596s1c1
Sequence:CCGGGTTCCGAAGTGTTAACCCAAACTCGAGTTTGGGTTAACACTTCGGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000163203    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_014399.2-798s1c1
Sequence:CCGGGCGAATCCTAGTGCATTCCTTCTCGAGAAGGAATGCACTAGGATTCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000292289    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014399.3-296s21c1
Sequence:CCGGGCTTTACACCTTGGTTAGTCTCTCGAGAGACTAACCAAGGTGTAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000292329    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014399.3-404s21c1
Sequence:CCGGCTTCTTGTTCCTGATTGCTTTCTCGAGAAAGCAATCAGGAACAAGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000292328    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014399.3-834s21c1
Sequence:CCGGGCGAATCCTAGTGCATTCCTTCTCGAGAAGGAATGCACTAGGATTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000292327    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014399.3-632s21c1
Sequence:CCGGGTTCCGAAGTGTTAACCCAAACTCGAGTTTGGGTTAACACTTCGGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014399
VALIDATED
TSPAN13 MISSION shRNA shRNA Plasmid DNA
tetraspanin 13
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000164054    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014399.2-613s1c1
Sequence:CCGGCAAATGACACCTGTCTGGCTACTCGAGTAGCCAGACAGGTGTCATTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000161337    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_014399.2-260s1c1
Sequence:CCGGGCTTTACACCTTGGTTAGTCTCTCGAGAGACTAACCAAGGTGTAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000160041    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014399.2-573s1c1
Sequence:CCGGCAGAGAAATCTAAACTGCTGTCTCGAGACAGCAGTTTAGATTTCTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000160162    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_014399.2-368s1c1
Sequence:CCGGCTTCTTGTTCCTGATTGCTTTCTCGAGAAAGCAATCAGGAACAAGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000160755    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014399.2-677s1c1
Sequence:CCGGCATAGGAGAATATGCTGGAGACTCGAGTCTCCAGCATATTCTCCTATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000161241    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_014399.2-596s1c1
Sequence:CCGGGTTCCGAAGTGTTAACCCAAACTCGAGTTTGGGTTAACACTTCGGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000163203    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_014399.2-798s1c1
Sequence:CCGGGCGAATCCTAGTGCATTCCTTCTCGAGAAGGAATGCACTAGGATTCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000292289    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014399.3-296s21c1
Sequence:CCGGGCTTTACACCTTGGTTAGTCTCTCGAGAGACTAACCAAGGTGTAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000292329    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014399.3-404s21c1
Sequence:CCGGCTTCTTGTTCCTGATTGCTTTCTCGAGAAAGCAATCAGGAACAAGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000292328    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014399.3-834s21c1
Sequence:CCGGGCGAATCCTAGTGCATTCCTTCTCGAGAAGGAATGCACTAGGATTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000292327    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014399.3-632s21c1
Sequence:CCGGGTTCCGAAGTGTTAACCCAAACTCGAGTTTGGGTTAACACTTCGGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014399
VALIDATED
TSPAN13 MISSION shRNA Lentiviral Transduction Particles
tetraspanin 13
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000164054    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014399.2-613s1c1
Sequence:CCGGCAAATGACACCTGTCTGGCTACTCGAGTAGCCAGACAGGTGTCATTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000161337    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_014399.2-260s1c1
Sequence:CCGGGCTTTACACCTTGGTTAGTCTCTCGAGAGACTAACCAAGGTGTAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000160041    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014399.2-573s1c1
Sequence:CCGGCAGAGAAATCTAAACTGCTGTCTCGAGACAGCAGTTTAGATTTCTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000160162    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_014399.2-368s1c1
Sequence:CCGGCTTCTTGTTCCTGATTGCTTTCTCGAGAAAGCAATCAGGAACAAGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000160755    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014399.2-677s1c1
Sequence:CCGGCATAGGAGAATATGCTGGAGACTCGAGTCTCCAGCATATTCTCCTATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000161241    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_014399.2-596s1c1
Sequence:CCGGGTTCCGAAGTGTTAACCCAAACTCGAGTTTGGGTTAACACTTCGGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000163203    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_014399.2-798s1c1
Sequence:CCGGGCGAATCCTAGTGCATTCCTTCTCGAGAAGGAATGCACTAGGATTCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000292289    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014399.3-296s21c1
Sequence:CCGGGCTTTACACCTTGGTTAGTCTCTCGAGAGACTAACCAAGGTGTAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000292329    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014399.3-404s21c1
Sequence:CCGGCTTCTTGTTCCTGATTGCTTTCTCGAGAAAGCAATCAGGAACAAGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000292328    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014399.3-834s21c1
Sequence:CCGGGCGAATCCTAGTGCATTCCTTCTCGAGAAGGAATGCACTAGGATTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000292327    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014399.3-632s21c1
Sequence:CCGGGTTCCGAAGTGTTAACCCAAACTCGAGTTTGGGTTAACACTTCGGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks