EMAIL THIS PAGE TO A FRIEND

TSPAN14

tetraspanin 14

Synonyms: DC-TM4F2 TM4SF14
Gene ID:
Mouse(52588) tetraspanin 14
Rat(306324) tetraspanin 14
Zebrafish(751700) tetraspanin 14
dog(610573) tetraspanin 14
domestic cat(101081082) tetraspanin 14
chicken(423624) tetraspanin 14
naked mole-rat(101711156) tetraspanin 14
cow(539055) tetraspanin 14
sheep(101109329) tetraspanin 14
Goat(100861085) tetraspanin 14
160 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_030927 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_030927 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_030927 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_145928 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_145928 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_145928 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001128309 Rosetta Predictions human pricing
NM_030927 Rosetta Predictions human pricing
XM_001067025 Rosetta Predictions rat pricing
XM_224699 Rosetta Predictions rat pricing
NM_145928 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001128309 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00331066 predicted 535
2 SASI_Hs02_00331067 predicted 463
3 SASI_Hs02_00331068 predicted 461
4 SASI_Hs02_00331069 predicted 517
5 SASI_Hs02_00331070 predicted 462
6 SASI_Hs02_00331071 predicted 327
7 SASI_Hs02_00331072 predicted 900
8 SASI_Hs02_00331073 predicted 759
9 SASI_Hs02_00331074 predicted 589
10 SASI_Hs02_00331075 predicted 599
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_030927 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00073180 predicted 500
2 SASI_Hs01_00073181 predicted 474
3 SASI_Hs01_00073182 predicted 797
4 SASI_Hs01_00073183 predicted 796
5 SASI_Hs01_00073184 predicted 558
6 SASI_Hs01_00073185 predicted 328
7 SASI_Hs01_00073186 predicted 857
8 SASI_Hs01_00073187 predicted 668
9 SASI_Hs01_00073188 predicted 1140
10 SASI_Hs01_00073189 predicted 1237
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001067025 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00319594 predicted 971
2 SASI_Rn02_00319595 predicted 1026
3 SASI_Rn02_00319596 predicted 328
4 SASI_Rn02_00319597 predicted 1046
5 SASI_Rn02_00319598 predicted 658
6 SASI_Rn02_00319599 predicted 299
7 SASI_Rn02_00319600 predicted 470
8 SASI_Rn02_00319601 predicted 824
9 SASI_Rn02_00319602 predicted 643
10 SASI_Rn02_00319603 predicted 973
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_224699 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00382184 predicted 974
2 SASI_Rn02_00382185 predicted 1026
3 SASI_Rn02_00382186 predicted 326
4 SASI_Rn02_00382187 predicted 1053
5 SASI_Rn02_00382188 predicted 650
6 SASI_Rn02_00382189 predicted 297
7 SASI_Rn02_00382190 predicted 471
8 SASI_Rn02_00382191 predicted 832
9 SASI_Rn02_00382192 predicted 644
10 SASI_Rn02_00382193 predicted 970
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145928 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00341382 predicted 768
2 SASI_Mm01_00060240 predicted 1041
3 SASI_Mm01_00060241 predicted 1211
4 SASI_Mm01_00060242 predicted 1217
5 SASI_Mm01_00060243 predicted 681
6 SASI_Mm01_00060245 predicted 980
7 SASI_Mm01_00060246 predicted 876
8 SASI_Mm01_00060247 predicted 1029
9 SASI_Mm01_00060248 predicted 1142
10 SASI_Mm01_00060249 predicted 875
11 SASI_Mm01_00060244 predicted 1233
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_030927
VALIDATED
TSPAN14 MISSION shRNA Bacterial Glycerol Stock
tetraspanin 14
Human
16 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000382426    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030927.2-745s21c1
Sequence:GTACCGGATGAGTCCATCTTCACGAAAGCTCGAGCTTTCGTGAAGATGGACTCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000382359    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030927.2-263s21c1
Sequence:GTACCGGAGTGACCCGGATGCATGGAATCTCGAGATTCCATGCATCCGGGTCACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000382437    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_030927.2-595s21c1
Sequence:GTACCGGACCTCAACGTCTACTTCAATTCTCGAGAATTGAAGTAGACGTTGAGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000318874    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030927.2-145s21c1
Sequence:CCGGGCTGGTACAAGTACCTCCTTTCTCGAGAAAGGAGGTACTTGTACCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000318942    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_030927.2-2265s21c1
Sequence:CCGGGCTCTTGGAAATGAAGTCTTACTCGAGTAAGACTTCATTTCCAAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000318941    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 2 Clone ID:NM_030927.2-1605s21c1
Sequence:CCGGCCTCTGGTCTTGATAGCATTACTCGAGTAATGCTATCAAGACCAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000349652    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030927.2-488s21c1
Sequence:CCGGCGAGAGCAACATCAAGTCCTACTCGAGTAGGACTTGATGTTGCTCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000380341    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 2 Clone ID:NM_030927.2-693s21c1
Sequence:GTACCGGGTGAACACACAGTGTGGATATCTCGAGATATCCACACTGTGTGTTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000158318    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_030927.1-1826s1c1
Sequence:CCGGCCTCTCTTTCTCCTCCACATACTCGAGTATGTGGAGGAGAAAGAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000158032    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1 Clone ID:NM_030927.1-459s1c1
Sequence:CCGGCGAGAGCAACATCAAGTCCTACTCGAGTAGGACTTGATGTTGCTCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000156964    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030927.1-116s1c1
Sequence:CCGGGCTGGTACAAGTACCTCCTTTCTCGAGAAAGGAGGTACTTGTACCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000157529    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_030927.1-505s1c1
Sequence:CCGGGTCATCGACTCCCTTCAGAAACTCGAGTTTCTGAAGGGAGTCGATGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000155210    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_030927.1-715s1c1
Sequence:CCGGGATGAGTCCATCTTCACGAAACTCGAGTTTCGTGAAGATGGACTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000154752    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_030927.1-816s1c1
Sequence:CCGGGCAGATATTTGGCATCTTCCTCTCGAGAGGAAGATGCCAAATATCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000151115    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_030927.1-2236s1c1
Sequence:CCGGGCTCTTGGAAATGAAGTCTTACTCGAGTAAGACTTCATTTCCAAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000154349    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_030927.1-1576s1c1
Sequence:CCGGCCTCTGGTCTTGATAGCATTACTCGAGTAATGCTATCAAGACCAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_030927
VALIDATED
TSPAN14 MISSION shRNA shRNA Plasmid DNA
tetraspanin 14
Human
16 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000382426    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030927.2-745s21c1
Sequence:GTACCGGATGAGTCCATCTTCACGAAAGCTCGAGCTTTCGTGAAGATGGACTCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000382359    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030927.2-263s21c1
Sequence:GTACCGGAGTGACCCGGATGCATGGAATCTCGAGATTCCATGCATCCGGGTCACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000382437    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_030927.2-595s21c1
Sequence:GTACCGGACCTCAACGTCTACTTCAATTCTCGAGAATTGAAGTAGACGTTGAGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000318874    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030927.2-145s21c1
Sequence:CCGGGCTGGTACAAGTACCTCCTTTCTCGAGAAAGGAGGTACTTGTACCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000318942    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_030927.2-2265s21c1
Sequence:CCGGGCTCTTGGAAATGAAGTCTTACTCGAGTAAGACTTCATTTCCAAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000318941    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 2 Clone ID:NM_030927.2-1605s21c1
Sequence:CCGGCCTCTGGTCTTGATAGCATTACTCGAGTAATGCTATCAAGACCAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000349652    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030927.2-488s21c1
Sequence:CCGGCGAGAGCAACATCAAGTCCTACTCGAGTAGGACTTGATGTTGCTCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000380341    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 2 Clone ID:NM_030927.2-693s21c1
Sequence:GTACCGGGTGAACACACAGTGTGGATATCTCGAGATATCCACACTGTGTGTTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000158318    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_030927.1-1826s1c1
Sequence:CCGGCCTCTCTTTCTCCTCCACATACTCGAGTATGTGGAGGAGAAAGAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000158032    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1 Clone ID:NM_030927.1-459s1c1
Sequence:CCGGCGAGAGCAACATCAAGTCCTACTCGAGTAGGACTTGATGTTGCTCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000156964    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030927.1-116s1c1
Sequence:CCGGGCTGGTACAAGTACCTCCTTTCTCGAGAAAGGAGGTACTTGTACCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000157529    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_030927.1-505s1c1
Sequence:CCGGGTCATCGACTCCCTTCAGAAACTCGAGTTTCTGAAGGGAGTCGATGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000155210    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_030927.1-715s1c1
Sequence:CCGGGATGAGTCCATCTTCACGAAACTCGAGTTTCGTGAAGATGGACTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000154752    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_030927.1-816s1c1
Sequence:CCGGGCAGATATTTGGCATCTTCCTCTCGAGAGGAAGATGCCAAATATCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000151115    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_030927.1-2236s1c1
Sequence:CCGGGCTCTTGGAAATGAAGTCTTACTCGAGTAAGACTTCATTTCCAAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000154349    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_030927.1-1576s1c1
Sequence:CCGGCCTCTGGTCTTGATAGCATTACTCGAGTAATGCTATCAAGACCAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_030927
VALIDATED
TSPAN14 MISSION shRNA Lentiviral Transduction Particles
tetraspanin 14
Human
16 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000382426    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030927.2-745s21c1
Sequence:GTACCGGATGAGTCCATCTTCACGAAAGCTCGAGCTTTCGTGAAGATGGACTCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000382359    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030927.2-263s21c1
Sequence:GTACCGGAGTGACCCGGATGCATGGAATCTCGAGATTCCATGCATCCGGGTCACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000382437    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_030927.2-595s21c1
Sequence:GTACCGGACCTCAACGTCTACTTCAATTCTCGAGAATTGAAGTAGACGTTGAGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000318874    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030927.2-145s21c1
Sequence:CCGGGCTGGTACAAGTACCTCCTTTCTCGAGAAAGGAGGTACTTGTACCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000318942    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_030927.2-2265s21c1
Sequence:CCGGGCTCTTGGAAATGAAGTCTTACTCGAGTAAGACTTCATTTCCAAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000318941    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 2 Clone ID:NM_030927.2-1605s21c1
Sequence:CCGGCCTCTGGTCTTGATAGCATTACTCGAGTAATGCTATCAAGACCAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000349652    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030927.2-488s21c1
Sequence:CCGGCGAGAGCAACATCAAGTCCTACTCGAGTAGGACTTGATGTTGCTCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000380341    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 2 Clone ID:NM_030927.2-693s21c1
Sequence:GTACCGGGTGAACACACAGTGTGGATATCTCGAGATATCCACACTGTGTGTTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000158318    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_030927.1-1826s1c1
Sequence:CCGGCCTCTCTTTCTCCTCCACATACTCGAGTATGTGGAGGAGAAAGAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000158032    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1 Clone ID:NM_030927.1-459s1c1
Sequence:CCGGCGAGAGCAACATCAAGTCCTACTCGAGTAGGACTTGATGTTGCTCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000156964    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030927.1-116s1c1
Sequence:CCGGGCTGGTACAAGTACCTCCTTTCTCGAGAAAGGAGGTACTTGTACCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000157529    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_030927.1-505s1c1
Sequence:CCGGGTCATCGACTCCCTTCAGAAACTCGAGTTTCTGAAGGGAGTCGATGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000155210    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_030927.1-715s1c1
Sequence:CCGGGATGAGTCCATCTTCACGAAACTCGAGTTTCGTGAAGATGGACTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000154752    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_030927.1-816s1c1
Sequence:CCGGGCAGATATTTGGCATCTTCCTCTCGAGAGGAAGATGCCAAATATCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000151115    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_030927.1-2236s1c1
Sequence:CCGGGCTCTTGGAAATGAAGTCTTACTCGAGTAAGACTTCATTTCCAAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000154349    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_030927.1-1576s1c1
Sequence:CCGGCCTCTGGTCTTGATAGCATTACTCGAGTAATGCTATCAAGACCAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_145928
VALIDATED
TSPAN14 MISSION shRNA Bacterial Glycerol Stock
tetraspanin 14
Mouse
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000381566    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145928.1-99s21c1
Sequence:GTACCGGACCTGCTCTTCAGCTACAATACTCGAGTATTGTAGCTGAAGAGCAGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000381356    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145928.1-681s21c1
Sequence:GTACCGGAGTGGGATGAGTTCATCTTTACTCGAGTAAAGATGAACTCATCCCACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000326779    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145928.1-647s21c1
Sequence:CCGGTGTGGCTATGATGTCCGGATTCTCGAGAATCCGGACATCATAGCCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000326778    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145928.1-736s21c1
Sequence:CCGGGCCCAGGAACATCTACATTGTCTCGAGACAATGTAGATGTTCCTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000326841    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145928.1-1493s21c1
Sequence:CCGGGCCTCGTTTCTCCATAGCATTCTCGAGAATGCTATGGAGAAACGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000354216    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145928.1-475s21c1
Sequence:CCGGCCTCATTGACTCCCTTCAGAACTCGAGTTCTGAAGGGAGTCAATGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000094934    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145928.1-1493s1c1
Sequence:CCGGGCCTCGTTTCTCCATAGCATTCTCGAGAATGCTATGGAGAAACGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000094938    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145928.1-647s1c1
Sequence:CCGGTGTGGCTATGATGTCCGGATTCTCGAGAATCCGGACATCATAGCCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000094935    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145928.1-475s1c1
Sequence:CCGGCCTCATTGACTCCCTTCAGAACTCGAGTTCTGAAGGGAGTCAATGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000094937    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145928.1-736s1c1
Sequence:CCGGGCCCAGGAACATCTACATTGTCTCGAGACAATGTAGATGTTCCTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000094936    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145928.1-88s1c1
Sequence:CCGGCTGGTACAAGTACCTGCTCTTCTCGAGAAGAGCAGGTACTTGTACCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_145928
VALIDATED
TSPAN14 MISSION shRNA shRNA Plasmid DNA
tetraspanin 14
Mouse
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000381566    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145928.1-99s21c1
Sequence:GTACCGGACCTGCTCTTCAGCTACAATACTCGAGTATTGTAGCTGAAGAGCAGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000381356    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145928.1-681s21c1
Sequence:GTACCGGAGTGGGATGAGTTCATCTTTACTCGAGTAAAGATGAACTCATCCCACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000326779    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145928.1-647s21c1
Sequence:CCGGTGTGGCTATGATGTCCGGATTCTCGAGAATCCGGACATCATAGCCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000326778    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145928.1-736s21c1
Sequence:CCGGGCCCAGGAACATCTACATTGTCTCGAGACAATGTAGATGTTCCTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000326841    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145928.1-1493s21c1
Sequence:CCGGGCCTCGTTTCTCCATAGCATTCTCGAGAATGCTATGGAGAAACGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000354216    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145928.1-475s21c1
Sequence:CCGGCCTCATTGACTCCCTTCAGAACTCGAGTTCTGAAGGGAGTCAATGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000094934    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145928.1-1493s1c1
Sequence:CCGGGCCTCGTTTCTCCATAGCATTCTCGAGAATGCTATGGAGAAACGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000094938    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145928.1-647s1c1
Sequence:CCGGTGTGGCTATGATGTCCGGATTCTCGAGAATCCGGACATCATAGCCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000094935    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145928.1-475s1c1
Sequence:CCGGCCTCATTGACTCCCTTCAGAACTCGAGTTCTGAAGGGAGTCAATGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000094937    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145928.1-736s1c1
Sequence:CCGGGCCCAGGAACATCTACATTGTCTCGAGACAATGTAGATGTTCCTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000094936    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145928.1-88s1c1
Sequence:CCGGCTGGTACAAGTACCTGCTCTTCTCGAGAAGAGCAGGTACTTGTACCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_145928
VALIDATED
TSPAN14 MISSION shRNA Lentiviral Transduction Particles
tetraspanin 14
Mouse
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000381566    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145928.1-99s21c1
Sequence:GTACCGGACCTGCTCTTCAGCTACAATACTCGAGTATTGTAGCTGAAGAGCAGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000381356    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145928.1-681s21c1
Sequence:GTACCGGAGTGGGATGAGTTCATCTTTACTCGAGTAAAGATGAACTCATCCCACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000326779    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145928.1-647s21c1
Sequence:CCGGTGTGGCTATGATGTCCGGATTCTCGAGAATCCGGACATCATAGCCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000326778    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145928.1-736s21c1
Sequence:CCGGGCCCAGGAACATCTACATTGTCTCGAGACAATGTAGATGTTCCTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000326841    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145928.1-1493s21c1
Sequence:CCGGGCCTCGTTTCTCCATAGCATTCTCGAGAATGCTATGGAGAAACGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000354216    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145928.1-475s21c1
Sequence:CCGGCCTCATTGACTCCCTTCAGAACTCGAGTTCTGAAGGGAGTCAATGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000094934    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145928.1-1493s1c1
Sequence:CCGGGCCTCGTTTCTCCATAGCATTCTCGAGAATGCTATGGAGAAACGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000094938    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145928.1-647s1c1
Sequence:CCGGTGTGGCTATGATGTCCGGATTCTCGAGAATCCGGACATCATAGCCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000094935    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145928.1-475s1c1
Sequence:CCGGCCTCATTGACTCCCTTCAGAACTCGAGTTCTGAAGGGAGTCAATGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000094937    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145928.1-736s1c1
Sequence:CCGGGCCCAGGAACATCTACATTGTCTCGAGACAATGTAGATGTTCCTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000094936    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145928.1-88s1c1
Sequence:CCGGCTGGTACAAGTACCTGCTCTTCTCGAGAAGAGCAGGTACTTGTACCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks