EMAIL THIS PAGE TO A FRIEND

TSPAN15

tetraspanin 15

Synonyms: 2700063A19Rik NET-7 NET7 TM4SF15
UniProtKB ID: O95858, Q6UW79
Gene ID:
Human(23555) Summary: The protein encoded by this gene is a member of the transmembrane 4 superfamily, also known as the tetraspanin family. Most of these members are cell-surface proteins that are characterized by the presence of four hydrophobic domains. The proteins mediate signal transduction events that play a role in the regulation of cell development, activation, growth and motility. The use of alternate polyadenylation sites has been found for this gene. [provided by RefSeq, Jul 2008]
Mouse(70423) tetraspanin 15
Rat(679462) tetraspanin 15
cow(522371) tetraspanin 15
sheep(101104803) tetraspanin 15
naked mole-rat(101709829) tetraspanin 15
Zebrafish(100000710) tetraspanin 15
chicken(423699) tetraspanin 15
dog(609466) tetraspanin 15
domestic cat(101094790) tetraspanin 15
48 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB2108604 Anti-TSPAN15 affinity isolated antibody rabbit, human, guinea pig, rabbit, rat, mouse, canine, bovine
western blot pricing
AV46889 Anti-TSPAN15 antibody produced in rabbit affinity isolated antibody mouse, rat, bovine, canine, human, horse, rabbit, guinea pig
western blot pricing
HPA044657 Anti-TSPAN15 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_012339 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_012339 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_012339 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_197996 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_197996 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_197996 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_012339 Rosetta Predictions human pricing
NM_001115032 Rosetta Predictions rat pricing
NM_197996 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012339 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00174409 predicted 739
2 SASI_Hs01_00174410 predicted 422
3 SASI_Hs01_00174411 predicted 773
4 SASI_Hs01_00174412 predicted 1297
5 SASI_Hs01_00174413 predicted 386
6 SASI_Hs01_00174414 predicted 377
7 SASI_Hs01_00174415 predicted 744
8 SASI_Hs01_00174416 predicted 467
9 SASI_Hs01_00174417 predicted 598
10 SASI_Hs01_00174418 predicted 258
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001115032 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00252493 predicted 351
2 SASI_Rn02_00252494 predicted 1007
3 SASI_Rn02_00252495 predicted 709
4 SASI_Rn02_00252496 predicted 439
5 SASI_Rn02_00252497 predicted 869
6 SASI_Rn02_00252498 predicted 299
7 SASI_Rn02_00252499 predicted 862
8 SASI_Rn02_00252500 predicted 414
9 SASI_Rn02_00252501 predicted 827
10 SASI_Rn02_00252502 predicted 914
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_197996 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00350689 predicted 1032
2 SASI_Mm02_00350690 predicted 1124
3 SASI_Mm01_00131432 predicted 456
4 SASI_Mm02_00350691 predicted 756
5 SASI_Mm01_00131434 predicted 447
6 SASI_Mm01_00131436 predicted 360
7 SASI_Mm02_00350692 predicted 414
8 SASI_Mm01_00131437 predicted 422
9 SASI_Mm01_00131440 predicted 309
10 SASI_Mm02_00350693 predicted 1107
11 SASI_Mm01_00131433 predicted 919
12 SASI_Mm01_00131435 predicted 824
13 SASI_Mm01_00131438 predicted 984
14 SASI_Mm01_00131439 predicted 826
15 SASI_Mm01_00131441 predicted 1079
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_012339
VALIDATED
TSPAN15 MISSION shRNA Bacterial Glycerol Stock
tetraspanin 15
Human
15 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000153662    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012339.2-391s1c1
Sequence:CCGGCCTTCTCCAAGCATTCATGTACTCGAGTACATGAATGCTTGGAGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000153023    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012339.2-799s1c1
Sequence:CCGGGTTCATGGACAACTACACCATCTCGAGATGGTGTAGTTGTCCATGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000153446    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012339.2-397s1c1
Sequence:CCGGCCAAGCATTCATGTACATCCTCTCGAGAGGATGTACATGAATGCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000158160    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012339.2-679s1c1
Sequence:CCGGCATCAGGAACACGACAGAAGTCTCGAGACTTCTGTCGTGTTCCTGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000157418    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_012339.2-612s1c1
Sequence:CCGGGCAAGAATCAGTACCACGACTCTCGAGAGTCGTGGTACTGATTCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000157727    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012339.2-690s1c1
Sequence:CCGGCGACAGAAGTTGTCAACACCACTCGAGTGGTGTTGACAACTTCTGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000381665    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012339.3-788s21c1
Sequence:GTACCGGCGCCGTGATCATCTGGTTCATCTCGAGATGAACCAGATGATCACGGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000381139    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012339.3-199s21c1
Sequence:GTACCGGTCATCTATTCCACCGTGTTCTCTCGAGAGAACACGGTGGAATAGATGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000380762    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012339.3-171s21c1
Sequence:GTACCGGTCCTACCTCTGGCTCAAGTTTCTCGAGAAACTTGAGCCAGAGGTAGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000219082    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_012339.3-514s21c1
Sequence:GTACCGGGAGGAATTGAGAACTACTATGCTCGAGCATAGTAGTTCTCAATTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000230020    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 2 Clone ID:NM_012339.3-490s21c1
Sequence:CCGGACTTCCTGAACGACAACATTCCTCGAGGAATGTTGTCGTTCAGGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000230019    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_012339.3-259s21c1
Sequence:CCGGCAGAGGTTGAGCGGCAGAAATCTCGAGATTTCTGCCGCTCAACCTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000230021    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_012339.3-604s21c1
Sequence:CCGGACCGAGATTGGAGCAAGAATCCTCGAGGATTCTTGCTCCAATCTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000230022    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_012339.3-1053s21c1
Sequence:CCGGTAGCACCTCTCAGTCAACATCCTCGAGGATGTTGACTGAGAGGTGCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000380708    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012339.3-343s21c1
Sequence:GTACCGGTGTTCATGGTCTCCTTCATTGCTCGAGCAATGAAGGAGACCATGAACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_012339
VALIDATED
TSPAN15 MISSION shRNA shRNA Plasmid DNA
tetraspanin 15
Human
15 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000153662    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012339.2-391s1c1
Sequence:CCGGCCTTCTCCAAGCATTCATGTACTCGAGTACATGAATGCTTGGAGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000153023    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012339.2-799s1c1
Sequence:CCGGGTTCATGGACAACTACACCATCTCGAGATGGTGTAGTTGTCCATGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000153446    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012339.2-397s1c1
Sequence:CCGGCCAAGCATTCATGTACATCCTCTCGAGAGGATGTACATGAATGCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000158160    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012339.2-679s1c1
Sequence:CCGGCATCAGGAACACGACAGAAGTCTCGAGACTTCTGTCGTGTTCCTGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000157418    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_012339.2-612s1c1
Sequence:CCGGGCAAGAATCAGTACCACGACTCTCGAGAGTCGTGGTACTGATTCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000157727    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012339.2-690s1c1
Sequence:CCGGCGACAGAAGTTGTCAACACCACTCGAGTGGTGTTGACAACTTCTGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000381665    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012339.3-788s21c1
Sequence:GTACCGGCGCCGTGATCATCTGGTTCATCTCGAGATGAACCAGATGATCACGGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000381139    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012339.3-199s21c1
Sequence:GTACCGGTCATCTATTCCACCGTGTTCTCTCGAGAGAACACGGTGGAATAGATGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000380762    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012339.3-171s21c1
Sequence:GTACCGGTCCTACCTCTGGCTCAAGTTTCTCGAGAAACTTGAGCCAGAGGTAGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000219082    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_012339.3-514s21c1
Sequence:GTACCGGGAGGAATTGAGAACTACTATGCTCGAGCATAGTAGTTCTCAATTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000230020    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 2 Clone ID:NM_012339.3-490s21c1
Sequence:CCGGACTTCCTGAACGACAACATTCCTCGAGGAATGTTGTCGTTCAGGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000230019    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_012339.3-259s21c1
Sequence:CCGGCAGAGGTTGAGCGGCAGAAATCTCGAGATTTCTGCCGCTCAACCTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000230021    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_012339.3-604s21c1
Sequence:CCGGACCGAGATTGGAGCAAGAATCCTCGAGGATTCTTGCTCCAATCTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000230022    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_012339.3-1053s21c1
Sequence:CCGGTAGCACCTCTCAGTCAACATCCTCGAGGATGTTGACTGAGAGGTGCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000380708    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012339.3-343s21c1
Sequence:GTACCGGTGTTCATGGTCTCCTTCATTGCTCGAGCAATGAAGGAGACCATGAACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_012339
VALIDATED
TSPAN15 MISSION shRNA Lentiviral Transduction Particles
tetraspanin 15
Human
15 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000153662    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012339.2-391s1c1
Sequence:CCGGCCTTCTCCAAGCATTCATGTACTCGAGTACATGAATGCTTGGAGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000153023    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012339.2-799s1c1
Sequence:CCGGGTTCATGGACAACTACACCATCTCGAGATGGTGTAGTTGTCCATGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000153446    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012339.2-397s1c1
Sequence:CCGGCCAAGCATTCATGTACATCCTCTCGAGAGGATGTACATGAATGCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000158160    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012339.2-679s1c1
Sequence:CCGGCATCAGGAACACGACAGAAGTCTCGAGACTTCTGTCGTGTTCCTGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000157418    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_012339.2-612s1c1
Sequence:CCGGGCAAGAATCAGTACCACGACTCTCGAGAGTCGTGGTACTGATTCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000157727    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012339.2-690s1c1
Sequence:CCGGCGACAGAAGTTGTCAACACCACTCGAGTGGTGTTGACAACTTCTGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000381665    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012339.3-788s21c1
Sequence:GTACCGGCGCCGTGATCATCTGGTTCATCTCGAGATGAACCAGATGATCACGGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000381139    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012339.3-199s21c1
Sequence:GTACCGGTCATCTATTCCACCGTGTTCTCTCGAGAGAACACGGTGGAATAGATGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000380762    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012339.3-171s21c1
Sequence:GTACCGGTCCTACCTCTGGCTCAAGTTTCTCGAGAAACTTGAGCCAGAGGTAGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000219082    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_012339.3-514s21c1
Sequence:GTACCGGGAGGAATTGAGAACTACTATGCTCGAGCATAGTAGTTCTCAATTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000230020    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 2 Clone ID:NM_012339.3-490s21c1
Sequence:CCGGACTTCCTGAACGACAACATTCCTCGAGGAATGTTGTCGTTCAGGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000230019    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_012339.3-259s21c1
Sequence:CCGGCAGAGGTTGAGCGGCAGAAATCTCGAGATTTCTGCCGCTCAACCTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000230021    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_012339.3-604s21c1
Sequence:CCGGACCGAGATTGGAGCAAGAATCCTCGAGGATTCTTGCTCCAATCTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000230022    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_012339.3-1053s21c1
Sequence:CCGGTAGCACCTCTCAGTCAACATCCTCGAGGATGTTGACTGAGAGGTGCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000380708    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012339.3-343s21c1
Sequence:GTACCGGTGTTCATGGTCTCCTTCATTGCTCGAGCAATGAAGGAGACCATGAACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_197996
TSPAN15 MISSION shRNA Bacterial Glycerol Stock
tetraspanin 15
Mouse
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000094164    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_197996.1-711s1c1
Sequence:CCGGCGCCGTGTTAATATGGTTCATCTCGAGATGAACCATATTAACACGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000094165    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_197996.1-109s1c1
Sequence:CCGGGCTCAAGTTCTCTCTCATCATCTCGAGATGATGAGAGAGAACTTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000094167    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_197996.1-406s1c1
Sequence:CCGGCCAGACTATTGACTTTCTGAACTCGAGTTCAGAAAGTCAATAGTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000094168    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_197996.1-427s1c1
Sequence:CCGGCGACAACATTCGGAGAGGAATCTCGAGATTCCTCTCCGAATGTTGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000094166    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_197996.1-400s1c1
Sequence:CCGGCCGGAACCAGACTATTGACTTCTCGAGAAGTCAATAGTCTGGTTCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000382468    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_197996.2-408s21c1
Sequence:GTACCGGGCCTGGTCATGGAGCTTATTGCTCGAGCAATAAGCTCCATGACCAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000381580    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_197996.2-1125s21c1
Sequence:GTACCGGGGGTGTATGTACCTGCGTATACTCGAGTATACGCAGGTACATACACCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000380914    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_197996.2-1039s21c1
Sequence:GTACCGGGTACTGCAAAGTGCATCTAAGCTCGAGCTTAGATGCACTTTGCAGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000379715    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_197996.2-370s21c1
Sequence:GTACCGGGTGCCTTCTGCAGTCGTTTATCTCGAGATAAACGACTGCAGAAGGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000380856    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_197996.2-870s21c1
Sequence:GTACCGGTCACCCGTGTGGAGGACATTACTCGAGTAATGTCCTCCACACGGGTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000381039    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_197996.2-1281s21c1
Sequence:GTACCGGGCCTTGGCCAGTGGTCATTATCTCGAGATAATGACCACTGGCCAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_197996
TSPAN15 MISSION shRNA shRNA Plasmid DNA
tetraspanin 15
Mouse
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000094164    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_197996.1-711s1c1
Sequence:CCGGCGCCGTGTTAATATGGTTCATCTCGAGATGAACCATATTAACACGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000094165    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_197996.1-109s1c1
Sequence:CCGGGCTCAAGTTCTCTCTCATCATCTCGAGATGATGAGAGAGAACTTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000094167    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_197996.1-406s1c1
Sequence:CCGGCCAGACTATTGACTTTCTGAACTCGAGTTCAGAAAGTCAATAGTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000094168    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_197996.1-427s1c1
Sequence:CCGGCGACAACATTCGGAGAGGAATCTCGAGATTCCTCTCCGAATGTTGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000094166    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_197996.1-400s1c1
Sequence:CCGGCCGGAACCAGACTATTGACTTCTCGAGAAGTCAATAGTCTGGTTCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000382468    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_197996.2-408s21c1
Sequence:GTACCGGGCCTGGTCATGGAGCTTATTGCTCGAGCAATAAGCTCCATGACCAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000381580    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_197996.2-1125s21c1
Sequence:GTACCGGGGGTGTATGTACCTGCGTATACTCGAGTATACGCAGGTACATACACCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000380914    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_197996.2-1039s21c1
Sequence:GTACCGGGTACTGCAAAGTGCATCTAAGCTCGAGCTTAGATGCACTTTGCAGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000379715    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_197996.2-370s21c1
Sequence:GTACCGGGTGCCTTCTGCAGTCGTTTATCTCGAGATAAACGACTGCAGAAGGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000380856    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_197996.2-870s21c1
Sequence:GTACCGGTCACCCGTGTGGAGGACATTACTCGAGTAATGTCCTCCACACGGGTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000381039    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_197996.2-1281s21c1
Sequence:GTACCGGGCCTTGGCCAGTGGTCATTATCTCGAGATAATGACCACTGGCCAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_197996
TSPAN15 MISSION shRNA Lentiviral Transduction Particles
tetraspanin 15
Mouse
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000094164    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_197996.1-711s1c1
Sequence:CCGGCGCCGTGTTAATATGGTTCATCTCGAGATGAACCATATTAACACGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000094165    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_197996.1-109s1c1
Sequence:CCGGGCTCAAGTTCTCTCTCATCATCTCGAGATGATGAGAGAGAACTTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000094167    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_197996.1-406s1c1
Sequence:CCGGCCAGACTATTGACTTTCTGAACTCGAGTTCAGAAAGTCAATAGTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000094168    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_197996.1-427s1c1
Sequence:CCGGCGACAACATTCGGAGAGGAATCTCGAGATTCCTCTCCGAATGTTGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000094166    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_197996.1-400s1c1
Sequence:CCGGCCGGAACCAGACTATTGACTTCTCGAGAAGTCAATAGTCTGGTTCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000382468    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_197996.2-408s21c1
Sequence:GTACCGGGCCTGGTCATGGAGCTTATTGCTCGAGCAATAAGCTCCATGACCAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000381580    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_197996.2-1125s21c1
Sequence:GTACCGGGGGTGTATGTACCTGCGTATACTCGAGTATACGCAGGTACATACACCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000380914    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_197996.2-1039s21c1
Sequence:GTACCGGGTACTGCAAAGTGCATCTAAGCTCGAGCTTAGATGCACTTTGCAGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000379715    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_197996.2-370s21c1
Sequence:GTACCGGGTGCCTTCTGCAGTCGTTTATCTCGAGATAAACGACTGCAGAAGGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000380856    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_197996.2-870s21c1
Sequence:GTACCGGTCACCCGTGTGGAGGACATTACTCGAGTAATGTCCTCCACACGGGTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000381039    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_197996.2-1281s21c1
Sequence:GTACCGGGCCTTGGCCAGTGGTCATTATCTCGAGATAATGACCACTGGCCAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks