EMAIL THIS PAGE TO A FRIEND

TSPAN16

tetraspanin 16

Synonyms: TM-8 TM4-B TM4SF16
UniProtKB ID: Q9UKR8
Gene ID:
Human(26526) Summary: The protein encoded by this gene is a member of the transmembrane 4 superfamily, also known as the tetraspanin family. Most of these members are cell-surface proteins that are characterized by the presence of four hydrophobic domains. The proteins mediate signal transduction events that play a role in the regulation of cell development, activation, growth and motility. This encoded protein might couple to signal transduction pathways and possibly modulate cellular activation and adhesion in haemopoietic and neural tissue. [provided by RefSeq, Jul 2008]
dog(100688972) tetraspanin 16
domestic cat(101080872) tetraspanin 16
naked mole-rat(101708876) tetraspanin 16
cow(521221) tetraspanin 16
sheep(101120080) tetraspanin 16
65 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_012466 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_012466 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_012466 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU158421 MISSION® esiRNA esiRNA human TSPAN16 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_012466 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012466 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00026087 predicted 523
2 SASI_Hs01_00026088 predicted 372
3 SASI_Hs01_00026089 predicted 236
4 SASI_Hs01_00026090 predicted 231
5 SASI_Hs01_00026091 predicted 421
6 SASI_Hs01_00026092 predicted 561
7 SASI_Hs01_00026093 predicted 301
8 SASI_Hs01_00026094 predicted 334
9 SASI_Hs01_00026095 predicted 547
10 SASI_Hs01_00026096 predicted 564
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_012466
TSPAN16 MISSION shRNA Bacterial Glycerol Stock
tetraspanin 16
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000428682    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012466.2-554s21c1
Sequence:CCGGACGAGCCAGACGACTATTCTACTCGAGTAGAATAGTCGTCTGGCTCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000426868    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012466.2-243s21c1
Sequence:CCAGCCTGGGCATTGGTGGTAAATGCTCGAGCATTTACCACCAATGCCCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000415858    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012466.2-418s21c1
Sequence:CCGGTGCATCCTGTCAATGGTTATTCTCGAGAATAACCATTGACAGGATGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000122659    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012466.2-460s1c1
Sequence:CCGGGCTGCCACAGTGGTCCTTCTTCTCGAGAAGAAGGACCACTGTGGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000121998    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012466.2-531s1c1
Sequence:CCGGGAGGAAGAATTACAGAGGTTACTCGAGTAACCTCTGTAATTCTTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000121985    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012466.2-641s1c1
Sequence:CCGGGCTCTTCCTTCGAAATGACAACTCGAGTTGTCATTTCGAAGGAAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000121653    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012466.2-755s1c1
Sequence:CCGGGCTGTTTCCATAAACTCCTAACTCGAGTTAGGAGTTTATGGAAACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000122168    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012466.2-192s1c1
Sequence:CCGGGTTATCTTTACTCAATGGCTTCTCGAGAAGCCATTGAGTAAAGATAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_012466
TSPAN16 MISSION shRNA shRNA Plasmid DNA
tetraspanin 16
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000428682    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012466.2-554s21c1
Sequence:CCGGACGAGCCAGACGACTATTCTACTCGAGTAGAATAGTCGTCTGGCTCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000426868    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012466.2-243s21c1
Sequence:CCAGCCTGGGCATTGGTGGTAAATGCTCGAGCATTTACCACCAATGCCCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000415858    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012466.2-418s21c1
Sequence:CCGGTGCATCCTGTCAATGGTTATTCTCGAGAATAACCATTGACAGGATGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000122659    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012466.2-460s1c1
Sequence:CCGGGCTGCCACAGTGGTCCTTCTTCTCGAGAAGAAGGACCACTGTGGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000121998    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012466.2-531s1c1
Sequence:CCGGGAGGAAGAATTACAGAGGTTACTCGAGTAACCTCTGTAATTCTTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000121985    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012466.2-641s1c1
Sequence:CCGGGCTCTTCCTTCGAAATGACAACTCGAGTTGTCATTTCGAAGGAAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000121653    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012466.2-755s1c1
Sequence:CCGGGCTGTTTCCATAAACTCCTAACTCGAGTTAGGAGTTTATGGAAACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000122168    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012466.2-192s1c1
Sequence:CCGGGTTATCTTTACTCAATGGCTTCTCGAGAAGCCATTGAGTAAAGATAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_012466
TSPAN16 MISSION shRNA Lentiviral Transduction Particles
tetraspanin 16
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000428682    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012466.2-554s21c1
Sequence:CCGGACGAGCCAGACGACTATTCTACTCGAGTAGAATAGTCGTCTGGCTCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000426868    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012466.2-243s21c1
Sequence:CCAGCCTGGGCATTGGTGGTAAATGCTCGAGCATTTACCACCAATGCCCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000415858    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012466.2-418s21c1
Sequence:CCGGTGCATCCTGTCAATGGTTATTCTCGAGAATAACCATTGACAGGATGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000122659    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012466.2-460s1c1
Sequence:CCGGGCTGCCACAGTGGTCCTTCTTCTCGAGAAGAAGGACCACTGTGGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000121998    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012466.2-531s1c1
Sequence:CCGGGAGGAAGAATTACAGAGGTTACTCGAGTAACCTCTGTAATTCTTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000121985    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012466.2-641s1c1
Sequence:CCGGGCTCTTCCTTCGAAATGACAACTCGAGTTGTCATTTCGAAGGAAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000121653    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012466.2-755s1c1
Sequence:CCGGGCTGTTTCCATAAACTCCTAACTCGAGTTAGGAGTTTATGGAAACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000122168    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012466.2-192s1c1
Sequence:CCGGGTTATCTTTACTCAATGGCTTCTCGAGAAGCCATTGAGTAAAGATAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks