EMAIL THIS PAGE TO A FRIEND

TSPAN17

tetraspanin 17

Synonyms: FBX23 FBXO23 TM4SF17
UniProtKB ID: Q96FV3, Q6NXF7, Q96S98, Q9UKB9
Gene ID:
Mouse(74257) tetraspanin 17
Rat(306771) tetraspanin 17
cow(509386) tetraspanin 17
sheep(101118692) tetraspanin 17
naked mole-rat(101707756) tetraspanin 17
Zebrafish(324950) tetraspanin 17
domestic cat(101080613) tetraspanin 17
dog(489098) tetraspanin 17
102 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_130465 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_130465 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_130465 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_028841 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_028841 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_028841 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001006616 Rosetta Predictions human pricing
NM_012171 Rosetta Predictions human pricing
NM_130465 Rosetta Predictions human pricing
NM_001013138 Rosetta Predictions rat pricing
NM_028841 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001006616 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00029820 predicted 590
2 SASI_Hs01_00029822 predicted 284
3 SASI_Hs01_00029824 predicted 517
4 SASI_Hs01_00029829 predicted 591
5 SASI_Hs01_00029825 predicted 487
6 SASI_Hs01_00029826 predicted 451
7 SASI_Hs01_00029827 predicted 482
8 SASI_Hs01_00029821 predicted 554
9 SASI_Hs01_00029828 predicted 999
10 SASI_Hs02_00305089 predicted 833
11 SASI_Hs01_00029823 predicted 572
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012171 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00090529 predicted 594
2 SASI_Hs01_00090531 predicted 281
3 SASI_Hs01_00090533 predicted 515
4 SASI_Hs01_00090534 predicted 593
5 SASI_Hs01_00090535 predicted 481
6 SASI_Hs02_00343772 predicted 1662
7 SASI_Hs01_00090536 predicted 454
8 SASI_Hs01_00090537 predicted 481
9 SASI_Hs01_00090538 predicted 1720
10 SASI_Hs02_00343773 predicted 236
11 SASI_Hs01_00090530 predicted 565
12 SASI_Hs01_00090532 predicted 572
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_130465 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00099250 predicted 596
2 SASI_Hs01_00099252 predicted 280
3 SASI_Hs01_00099254 predicted 513
4 SASI_Hs01_00099255 predicted 589
5 SASI_Hs01_00099256 predicted 484
6 SASI_Hs02_00362754 predicted 1660
7 SASI_Hs01_00099257 predicted 450
8 SASI_Hs01_00099258 predicted 482
9 SASI_Hs01_00099259 predicted 1708
10 SASI_Hs02_00362755 predicted 234
11 SASI_Hs01_00099251 predicted 559
12 SASI_Hs01_00099253 predicted 574
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001013138 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00113208 predicted 843
2 SASI_Rn01_00113209 predicted 737
3 SASI_Rn02_00200862 predicted 607
4 SASI_Rn01_00113210 predicted 500
5 SASI_Rn01_00113211 predicted 797
6 SASI_Rn01_00113212 predicted 419
7 SASI_Rn01_00113213 predicted 463
8 SASI_Rn01_00113214 predicted 754
9 SASI_Rn01_00113215 predicted 781
10 SASI_Rn01_00113216 predicted 481
11 SASI_Rn01_00113217 predicted 644
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_028841 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00053297 predicted 613
2 SASI_Mm01_00053298 predicted 733
3 SASI_Mm01_00053299 predicted 496
4 SASI_Mm01_00053300 predicted 479
5 SASI_Mm01_00053301 predicted 748
6 SASI_Mm01_00053302 predicted 738
7 SASI_Mm01_00053303 predicted 730
8 SASI_Mm01_00053304 predicted 725
9 SASI_Mm01_00053305 predicted 617
10 SASI_Mm01_00053306 predicted 503
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_130465
VALIDATED
TSPAN17 MISSION shRNA Bacterial Glycerol Stock
tetraspanin 17
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000034304    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_130465.1-532s1c1
Sequence:CCGGCCCAATGACTGGAACCTCAATCTCGAGATTGAGGTTCCAGTCATTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000034305    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_130465.1-97s1c1
Sequence:CCGGTGCGGGAAATACTTCCTGTTTCTCGAGAAACAGGAAGTATTTCCCGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000034307    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_130465.1-693s1c1
Sequence:CCGGGCAGGGCTTCATCCACACCAACTCGAGTTGGTGTGGATGAAGCCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000034308    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130465.1-820s1c1
Sequence:CCGGCAGAACCTCGAGCAAATGGAACTCGAGTTCCATTTGCTCGAGGTTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000034306    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130465.1-426s1c1
Sequence:CCGGCAACCTCTTCATCAACAACAACTCGAGTTGTTGTTGATGAAGAGGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000443240    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_130465.3-366s21c1
Sequence:CCGGAGGGCGTTCTCTCGAACATCTCTCGAGAGATGTTCGAGAGAACGCCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000413702    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_130465.3-1188s21c1
Sequence:CCGGTATACCCTGAGCCAACCTTTACTCGAGTAAAGGTTGGCTCAGGGTATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000415451    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_130465.3-1666s21c1
Sequence:CCGGAGGAGTCAAGTTCAGCATCTTCTCGAGAAGATGCTGAACTTGACTCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000420796    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_130465.3-1027s21c1
Sequence:CCGGGAAAGCCAACTGGAGCAAATGCTCGAGCATTTGCTCCAGTTGGCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000437512    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_130465.3-1393s21c1
Sequence:CCGGTCCCACCTCTGCAGGGTTATTCTCGAGAATAACCCTGCAGAGGTGGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000437817    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_130465.3-1068s21c1
Sequence:CCGGACTGGCTTACGCCCACCATTTCTCGAGAAATGGTGGGCGTAAGCCAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000438314    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_130465.3-1340s21c1
Sequence:CCGGGCCCGTTCTACTCACCTAAGTCTCGAGACTTAGGTGAGTAGAACGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_130465
VALIDATED
TSPAN17 MISSION shRNA shRNA Plasmid DNA
tetraspanin 17
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000034304    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_130465.1-532s1c1
Sequence:CCGGCCCAATGACTGGAACCTCAATCTCGAGATTGAGGTTCCAGTCATTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000034305    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_130465.1-97s1c1
Sequence:CCGGTGCGGGAAATACTTCCTGTTTCTCGAGAAACAGGAAGTATTTCCCGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000034307    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_130465.1-693s1c1
Sequence:CCGGGCAGGGCTTCATCCACACCAACTCGAGTTGGTGTGGATGAAGCCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000034308    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130465.1-820s1c1
Sequence:CCGGCAGAACCTCGAGCAAATGGAACTCGAGTTCCATTTGCTCGAGGTTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000034306    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130465.1-426s1c1
Sequence:CCGGCAACCTCTTCATCAACAACAACTCGAGTTGTTGTTGATGAAGAGGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000443240    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_130465.3-366s21c1
Sequence:CCGGAGGGCGTTCTCTCGAACATCTCTCGAGAGATGTTCGAGAGAACGCCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000413702    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_130465.3-1188s21c1
Sequence:CCGGTATACCCTGAGCCAACCTTTACTCGAGTAAAGGTTGGCTCAGGGTATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000415451    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_130465.3-1666s21c1
Sequence:CCGGAGGAGTCAAGTTCAGCATCTTCTCGAGAAGATGCTGAACTTGACTCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000420796    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_130465.3-1027s21c1
Sequence:CCGGGAAAGCCAACTGGAGCAAATGCTCGAGCATTTGCTCCAGTTGGCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000437512    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_130465.3-1393s21c1
Sequence:CCGGTCCCACCTCTGCAGGGTTATTCTCGAGAATAACCCTGCAGAGGTGGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000437817    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_130465.3-1068s21c1
Sequence:CCGGACTGGCTTACGCCCACCATTTCTCGAGAAATGGTGGGCGTAAGCCAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000438314    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_130465.3-1340s21c1
Sequence:CCGGGCCCGTTCTACTCACCTAAGTCTCGAGACTTAGGTGAGTAGAACGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_130465
VALIDATED
TSPAN17 MISSION shRNA Lentiviral Transduction Particles
tetraspanin 17
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000034304    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_130465.1-532s1c1
Sequence:CCGGCCCAATGACTGGAACCTCAATCTCGAGATTGAGGTTCCAGTCATTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000034305    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_130465.1-97s1c1
Sequence:CCGGTGCGGGAAATACTTCCTGTTTCTCGAGAAACAGGAAGTATTTCCCGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000034307    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_130465.1-693s1c1
Sequence:CCGGGCAGGGCTTCATCCACACCAACTCGAGTTGGTGTGGATGAAGCCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000034308    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130465.1-820s1c1
Sequence:CCGGCAGAACCTCGAGCAAATGGAACTCGAGTTCCATTTGCTCGAGGTTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000034306    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130465.1-426s1c1
Sequence:CCGGCAACCTCTTCATCAACAACAACTCGAGTTGTTGTTGATGAAGAGGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000443240    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_130465.3-366s21c1
Sequence:CCGGAGGGCGTTCTCTCGAACATCTCTCGAGAGATGTTCGAGAGAACGCCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000413702    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_130465.3-1188s21c1
Sequence:CCGGTATACCCTGAGCCAACCTTTACTCGAGTAAAGGTTGGCTCAGGGTATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000415451    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_130465.3-1666s21c1
Sequence:CCGGAGGAGTCAAGTTCAGCATCTTCTCGAGAAGATGCTGAACTTGACTCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000420796    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_130465.3-1027s21c1
Sequence:CCGGGAAAGCCAACTGGAGCAAATGCTCGAGCATTTGCTCCAGTTGGCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000437512    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_130465.3-1393s21c1
Sequence:CCGGTCCCACCTCTGCAGGGTTATTCTCGAGAATAACCCTGCAGAGGTGGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000437817    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_130465.3-1068s21c1
Sequence:CCGGACTGGCTTACGCCCACCATTTCTCGAGAAATGGTGGGCGTAAGCCAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000438314    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_130465.3-1340s21c1
Sequence:CCGGGCCCGTTCTACTCACCTAAGTCTCGAGACTTAGGTGAGTAGAACGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_028841
VALIDATED
TSPAN17 MISSION shRNA Bacterial Glycerol Stock
tetraspanin 17
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000094759    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_028841.1-1302s1c1
Sequence:CCGGGATGTATCTGTGTGTGGCTTACTCGAGTAAGCCACACACAGATACATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000094762    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028841.1-558s1c1
Sequence:CCGGCCTTCAGAACCTTATCGACTTCTCGAGAAGTCGATAAGGTTCTGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000094763    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028841.1-180s1c1
Sequence:CCGGCTGCGGGAAATACTTCCTGTTCTCGAGAACAGGAAGTATTTCCCGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000094760    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028841.1-498s1c1
Sequence:CCGGCCGAGACCAACTTAATCTCTTCTCGAGAAGAGATTAAGTTGGTCTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000094761    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028841.1-712s1c1
Sequence:CCGGCCAGCGGAAGATGTCCTCAATCTCGAGATTGAGGACATCTTCCGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000323865    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028841.2-711s21c1
Sequence:CCGGCCAGCGGAAGATGTCCTCAATCTCGAGATTGAGGACATCTTCCGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000323863    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028841.2-557s21c1
Sequence:CCGGCCTTCAGAACCTTATCGACTTCTCGAGAAGTCGATAAGGTTCTGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000323862    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028841.2-179s21c1
Sequence:CCGGCTGCGGGAAATACTTCCTGTTCTCGAGAACAGGAAGTATTTCCCGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000323928    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028841.2-497s21c1
Sequence:CCGGCCGAGACCAACTTAATCTCTTCTCGAGAAGAGATTAAGTTGGTCTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_028841
VALIDATED
TSPAN17 MISSION shRNA shRNA Plasmid DNA
tetraspanin 17
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000094759    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_028841.1-1302s1c1
Sequence:CCGGGATGTATCTGTGTGTGGCTTACTCGAGTAAGCCACACACAGATACATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000094762    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028841.1-558s1c1
Sequence:CCGGCCTTCAGAACCTTATCGACTTCTCGAGAAGTCGATAAGGTTCTGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000094763    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028841.1-180s1c1
Sequence:CCGGCTGCGGGAAATACTTCCTGTTCTCGAGAACAGGAAGTATTTCCCGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000094760    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028841.1-498s1c1
Sequence:CCGGCCGAGACCAACTTAATCTCTTCTCGAGAAGAGATTAAGTTGGTCTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000094761    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028841.1-712s1c1
Sequence:CCGGCCAGCGGAAGATGTCCTCAATCTCGAGATTGAGGACATCTTCCGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000323865    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028841.2-711s21c1
Sequence:CCGGCCAGCGGAAGATGTCCTCAATCTCGAGATTGAGGACATCTTCCGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000323863    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028841.2-557s21c1
Sequence:CCGGCCTTCAGAACCTTATCGACTTCTCGAGAAGTCGATAAGGTTCTGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000323862    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028841.2-179s21c1
Sequence:CCGGCTGCGGGAAATACTTCCTGTTCTCGAGAACAGGAAGTATTTCCCGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000323928    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028841.2-497s21c1
Sequence:CCGGCCGAGACCAACTTAATCTCTTCTCGAGAAGAGATTAAGTTGGTCTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_028841
VALIDATED
TSPAN17 MISSION shRNA Lentiviral Transduction Particles
tetraspanin 17
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000094759    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_028841.1-1302s1c1
Sequence:CCGGGATGTATCTGTGTGTGGCTTACTCGAGTAAGCCACACACAGATACATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000094762    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028841.1-558s1c1
Sequence:CCGGCCTTCAGAACCTTATCGACTTCTCGAGAAGTCGATAAGGTTCTGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000094763    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028841.1-180s1c1
Sequence:CCGGCTGCGGGAAATACTTCCTGTTCTCGAGAACAGGAAGTATTTCCCGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000094760    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028841.1-498s1c1
Sequence:CCGGCCGAGACCAACTTAATCTCTTCTCGAGAAGAGATTAAGTTGGTCTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000094761    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028841.1-712s1c1
Sequence:CCGGCCAGCGGAAGATGTCCTCAATCTCGAGATTGAGGACATCTTCCGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000323865    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028841.2-711s21c1
Sequence:CCGGCCAGCGGAAGATGTCCTCAATCTCGAGATTGAGGACATCTTCCGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000323863    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028841.2-557s21c1
Sequence:CCGGCCTTCAGAACCTTATCGACTTCTCGAGAAGTCGATAAGGTTCTGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000323862    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028841.2-179s21c1
Sequence:CCGGCTGCGGGAAATACTTCCTGTTCTCGAGAACAGGAAGTATTTCCCGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000323928    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028841.2-497s21c1
Sequence:CCGGCCGAGACCAACTTAATCTCTTCTCGAGAAGAGATTAAGTTGGTCTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks