EMAIL THIS PAGE TO A FRIEND

TSPAN18

tetraspanin 18

Synonyms: TSPAN
UniProtKB ID: Q96SJ8, Q6UY44, Q8NBI9
Gene ID:
Mouse(241556) tetraspanin 18
Rat(311210) tetraspanin 18
chicken(395586) tetraspanin 18
domestic cat(101084570) tetraspanin 18
dog(611375) tetraspanin 18
naked mole-rat(101712862) tetraspanin 18
cow(783765) tetraspanin 18
sheep(101111390) tetraspanin 18
52 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1302268 ANTI-TSPAN18 (CENTER) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_130783 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_130783 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_130783 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_183180 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_183180 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_183180 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001031730 Rosetta Predictions human pricing
NM_130783 Rosetta Predictions human pricing
NM_001107750 Rosetta Predictions rat pricing
NM_183180 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001031730 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00142215 predicted 948
2 SASI_Hs01_00142217 predicted 629
3 SASI_Hs01_00142218 predicted 712
4 SASI_Hs01_00142219 predicted 714
5 SASI_Hs01_00142220 predicted 247
6 SASI_Hs01_00142221 predicted 894
7 SASI_Hs01_00142222 predicted 649
8 SASI_Hs01_00142223 predicted 626
9 SASI_Hs01_00142224 predicted 455
10 SASI_Hs02_00307781 predicted 314
11 SASI_Hs01_00142216 predicted 959
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_130783 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00139164 predicted 783
2 SASI_Hs01_00139165 predicted 862
3 SASI_Hs01_00139166 predicted 390
4 SASI_Hs01_00139167 predicted 197
5 SASI_Hs01_00139168 predicted 1170
6 SASI_Hs01_00139170 predicted 250
7 SASI_Hs01_00139171 predicted 794
8 SASI_Hs01_00139172 predicted 770
9 SASI_Hs01_00139173 predicted 291
10 SASI_Hs02_00362816 predicted 316
11 SASI_Hs01_00139169 predicted 1210
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107750 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00231895 predicted 509
2 SASI_Rn02_00231896 predicted 1684
3 SASI_Rn02_00231897 predicted 1741
4 SASI_Rn02_00231898 predicted 978
5 SASI_Rn02_00231899 predicted 1737
6 SASI_Rn02_00231900 predicted 1735
7 SASI_Rn02_00231901 predicted 1718
8 SASI_Rn02_00231902 predicted 529
9 SASI_Rn02_00231903 predicted 521
10 SASI_Rn02_00231904 predicted 1116
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_183180 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00173918 predicted 568
2 SASI_Mm01_00173919 predicted 978
3 SASI_Mm01_00173920 predicted 765
4 SASI_Mm01_00173921 predicted 708
5 SASI_Mm01_00173922 predicted 1005
6 SASI_Mm01_00173923 predicted 809
7 SASI_Mm01_00173924 predicted 750
8 SASI_Mm01_00173925 predicted 741
9 SASI_Mm01_00173926 predicted 1013
10 SASI_Mm01_00173927 predicted 619
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_130783
VALIDATED
TSPAN18 MISSION shRNA Bacterial Glycerol Stock
tetraspanin 18
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000382302    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_130783.3-188s21c1
Sequence:GTACCGGGAAGTATCTGATGTTTGTATTCTCGAGAATACAAACATCAGATACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000381992    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_130783.3-464s21c1
Sequence:GTACCGGAGCCATCCTGGCCTTCATCTTCTCGAGAAGATGAAGGCCAGGATGGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000380023    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_130783.3-635s21c1
Sequence:GTACCGGTGCATCTGTGTTTCGACTCCTCTCGAGAGGAGTCGAAACACAGATGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000380333    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_130783.3-390s21c1
Sequence:GTACCGGGTCCGTGAGAACAAGTGTCTGCTCGAGCAGACACTTGTTCTCACGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000380534    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_130783.3-577s21c1
Sequence:GTACCGGACTCGGTCATGATCACATTTGCTCGAGCAAATGTGATCATGACCGAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000380583    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_130783.3-544s21c1
Sequence:GTACCGGATAACGACACAGACATCTTCTCTCGAGAGAAGATGTCTGTGTCGTTATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000381462    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_130783.3-778s21c1
Sequence:GTACCGGGCTGTTACACGGTGATCCTCACTCGAGTGAGGATCACCGTGTAACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000119217    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_130783.2-2330s1c1
Sequence:CCGGCCACAAGTATTCAGTTCTCAACTCGAGTTGAGAACTGAATACTTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000119220    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_130783.2-501s1c1
Sequence:CCGGCCGAGAATTCTTCACCAAGGACTCGAGTCCTTGGTGAAGAATTCTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000119221    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_130783.2-498s1c1
Sequence:CCGGCACCCGAGAATTCTTCACCAACTCGAGTTGGTGAAGAATTCTCGGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000119219    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130783.2-774s1c1
Sequence:CCGGGCAGGGCTGTTACACGGTGATCTCGAGATCACCGTGTAACAGCCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000119218    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130783.2-620s1c1
Sequence:CCGGCTGAAGACTTTAAGTTTGCATCTCGAGATGCAAACTTAAAGTCTTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_130783
VALIDATED
TSPAN18 MISSION shRNA shRNA Plasmid DNA
tetraspanin 18
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000382302    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_130783.3-188s21c1
Sequence:GTACCGGGAAGTATCTGATGTTTGTATTCTCGAGAATACAAACATCAGATACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000381992    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_130783.3-464s21c1
Sequence:GTACCGGAGCCATCCTGGCCTTCATCTTCTCGAGAAGATGAAGGCCAGGATGGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000380023    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_130783.3-635s21c1
Sequence:GTACCGGTGCATCTGTGTTTCGACTCCTCTCGAGAGGAGTCGAAACACAGATGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000380333    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_130783.3-390s21c1
Sequence:GTACCGGGTCCGTGAGAACAAGTGTCTGCTCGAGCAGACACTTGTTCTCACGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000380534    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_130783.3-577s21c1
Sequence:GTACCGGACTCGGTCATGATCACATTTGCTCGAGCAAATGTGATCATGACCGAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000380583    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_130783.3-544s21c1
Sequence:GTACCGGATAACGACACAGACATCTTCTCTCGAGAGAAGATGTCTGTGTCGTTATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000381462    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_130783.3-778s21c1
Sequence:GTACCGGGCTGTTACACGGTGATCCTCACTCGAGTGAGGATCACCGTGTAACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000119217    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_130783.2-2330s1c1
Sequence:CCGGCCACAAGTATTCAGTTCTCAACTCGAGTTGAGAACTGAATACTTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000119220    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_130783.2-501s1c1
Sequence:CCGGCCGAGAATTCTTCACCAAGGACTCGAGTCCTTGGTGAAGAATTCTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000119221    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_130783.2-498s1c1
Sequence:CCGGCACCCGAGAATTCTTCACCAACTCGAGTTGGTGAAGAATTCTCGGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000119219    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130783.2-774s1c1
Sequence:CCGGGCAGGGCTGTTACACGGTGATCTCGAGATCACCGTGTAACAGCCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000119218    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130783.2-620s1c1
Sequence:CCGGCTGAAGACTTTAAGTTTGCATCTCGAGATGCAAACTTAAAGTCTTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_130783
VALIDATED
TSPAN18 MISSION shRNA Lentiviral Transduction Particles
tetraspanin 18
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000382302    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_130783.3-188s21c1
Sequence:GTACCGGGAAGTATCTGATGTTTGTATTCTCGAGAATACAAACATCAGATACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000381992    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_130783.3-464s21c1
Sequence:GTACCGGAGCCATCCTGGCCTTCATCTTCTCGAGAAGATGAAGGCCAGGATGGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000380023    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_130783.3-635s21c1
Sequence:GTACCGGTGCATCTGTGTTTCGACTCCTCTCGAGAGGAGTCGAAACACAGATGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000380333    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_130783.3-390s21c1
Sequence:GTACCGGGTCCGTGAGAACAAGTGTCTGCTCGAGCAGACACTTGTTCTCACGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000380534    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_130783.3-577s21c1
Sequence:GTACCGGACTCGGTCATGATCACATTTGCTCGAGCAAATGTGATCATGACCGAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000380583    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_130783.3-544s21c1
Sequence:GTACCGGATAACGACACAGACATCTTCTCTCGAGAGAAGATGTCTGTGTCGTTATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000381462    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_130783.3-778s21c1
Sequence:GTACCGGGCTGTTACACGGTGATCCTCACTCGAGTGAGGATCACCGTGTAACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000119217    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_130783.2-2330s1c1
Sequence:CCGGCCACAAGTATTCAGTTCTCAACTCGAGTTGAGAACTGAATACTTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000119220    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_130783.2-501s1c1
Sequence:CCGGCCGAGAATTCTTCACCAAGGACTCGAGTCCTTGGTGAAGAATTCTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000119221    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_130783.2-498s1c1
Sequence:CCGGCACCCGAGAATTCTTCACCAACTCGAGTTGGTGAAGAATTCTCGGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000119219    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130783.2-774s1c1
Sequence:CCGGGCAGGGCTGTTACACGGTGATCTCGAGATCACCGTGTAACAGCCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000119218    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130783.2-620s1c1
Sequence:CCGGCTGAAGACTTTAAGTTTGCATCTCGAGATGCAAACTTAAAGTCTTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_183180
TSPAN18 MISSION shRNA Bacterial Glycerol Stock
tetraspanin 18
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000379575    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_183180.2-1440s21c1
Sequence:GTACCGGGGATCACCTCTCTTAGCATTTCTCGAGAAATGCTAAGAGAGGTGATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000379719    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_183180.2-1470s21c1
Sequence:GTACCGGGAGCAACCAGGAGGTAGAAACCTCGAGGTTTCTACCTCCTGGTTGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000379995    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183180.2-805s21c1
Sequence:GTACCGGATTCAGTCATGATCACATTTGCTCGAGCAAATGTGATCATGACTGAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000380179    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183180.2-755s21c1
Sequence:GTACCGGCAAGCACTACCAAGGCGATAACTCGAGTTATCGCCTTGGTAGTGCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000381213    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_183180.2-1238s21c1
Sequence:GTACCGGCCAGAAGCATAGAGCTAATTTCTCGAGAAATTAGCTCTATGCTTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000094689    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_183180.1-2185s1c1
Sequence:CCGGCCCAGACTAATAGGTTCACAACTCGAGTTGTGAACCTATTAGTCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000094691    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183180.1-1028s1c1
Sequence:CCGGGCCATTGGAGTACTGGCTATTCTCGAGAATAGCCAGTACTCCAATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000094693    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183180.1-589s1c1
Sequence:CCGGGAACAGGTGTCTGCTGCTATTCTCGAGAATAGCAGCAGACACCTGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000094692    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183180.1-471s1c1
Sequence:CCGGGCTTCCGAGAAATCGTGGCTACTCGAGTAGCCACGATTTCTCGGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000094690    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183180.1-732s1c1
Sequence:CCGGGCGATAACGATACGGATGTTTCTCGAGAAACATCCGTATCGTTATCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_183180
TSPAN18 MISSION shRNA shRNA Plasmid DNA
tetraspanin 18
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000379575    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_183180.2-1440s21c1
Sequence:GTACCGGGGATCACCTCTCTTAGCATTTCTCGAGAAATGCTAAGAGAGGTGATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000379719    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_183180.2-1470s21c1
Sequence:GTACCGGGAGCAACCAGGAGGTAGAAACCTCGAGGTTTCTACCTCCTGGTTGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000379995    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183180.2-805s21c1
Sequence:GTACCGGATTCAGTCATGATCACATTTGCTCGAGCAAATGTGATCATGACTGAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000380179    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183180.2-755s21c1
Sequence:GTACCGGCAAGCACTACCAAGGCGATAACTCGAGTTATCGCCTTGGTAGTGCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000381213    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_183180.2-1238s21c1
Sequence:GTACCGGCCAGAAGCATAGAGCTAATTTCTCGAGAAATTAGCTCTATGCTTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000094689    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_183180.1-2185s1c1
Sequence:CCGGCCCAGACTAATAGGTTCACAACTCGAGTTGTGAACCTATTAGTCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000094691    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183180.1-1028s1c1
Sequence:CCGGGCCATTGGAGTACTGGCTATTCTCGAGAATAGCCAGTACTCCAATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000094693    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183180.1-589s1c1
Sequence:CCGGGAACAGGTGTCTGCTGCTATTCTCGAGAATAGCAGCAGACACCTGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000094692    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183180.1-471s1c1
Sequence:CCGGGCTTCCGAGAAATCGTGGCTACTCGAGTAGCCACGATTTCTCGGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000094690    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183180.1-732s1c1
Sequence:CCGGGCGATAACGATACGGATGTTTCTCGAGAAACATCCGTATCGTTATCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_183180
TSPAN18 MISSION shRNA Lentiviral Transduction Particles
tetraspanin 18
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000379575    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_183180.2-1440s21c1
Sequence:GTACCGGGGATCACCTCTCTTAGCATTTCTCGAGAAATGCTAAGAGAGGTGATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000379719    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_183180.2-1470s21c1
Sequence:GTACCGGGAGCAACCAGGAGGTAGAAACCTCGAGGTTTCTACCTCCTGGTTGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000379995    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183180.2-805s21c1
Sequence:GTACCGGATTCAGTCATGATCACATTTGCTCGAGCAAATGTGATCATGACTGAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000380179    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_183180.2-755s21c1
Sequence:GTACCGGCAAGCACTACCAAGGCGATAACTCGAGTTATCGCCTTGGTAGTGCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000381213    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_183180.2-1238s21c1
Sequence:GTACCGGCCAGAAGCATAGAGCTAATTTCTCGAGAAATTAGCTCTATGCTTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000094689    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_183180.1-2185s1c1
Sequence:CCGGCCCAGACTAATAGGTTCACAACTCGAGTTGTGAACCTATTAGTCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000094691    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183180.1-1028s1c1
Sequence:CCGGGCCATTGGAGTACTGGCTATTCTCGAGAATAGCCAGTACTCCAATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000094693    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183180.1-589s1c1
Sequence:CCGGGAACAGGTGTCTGCTGCTATTCTCGAGAATAGCAGCAGACACCTGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000094692    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183180.1-471s1c1
Sequence:CCGGGCTTCCGAGAAATCGTGGCTACTCGAGTAGCCACGATTTCTCGGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000094690    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183180.1-732s1c1
Sequence:CCGGGCGATAACGATACGGATGTTTCTCGAGAAACATCCGTATCGTTATCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks