EMAIL THIS PAGE TO A FRIEND

TSPAN19

tetraspanin 19

UniProtKB ID: P0C672
Gene ID:
chicken(100859115) tetraspanin 19
dog(100685354) tetraspanin 19
domestic cat(101098969) tetraspanin 19
cow(781222) tetraspanin 19
sheep(101107267) tetraspanin 19
26 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001100917 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001100917 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001100917 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU220231 MISSION® esiRNA esiRNA targeting human TSPAN19 human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001100917 Rosetta Predictions human pricing
XM_084868 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001100917 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00322545 predicted 346
2 SASI_Hs02_00322546 predicted 404
3 SASI_Hs02_00322547 predicted 425
4 SASI_Hs02_00322548 predicted 500
5 SASI_Hs02_00322549 predicted 341
6 SASI_Hs02_00322550 predicted 677
7 SASI_Hs02_00322551 predicted 784
8 SASI_Hs02_00322552 predicted 485
9 SASI_Hs02_00322553 predicted 513
10 SASI_Hs02_00322554 predicted 353
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_084868 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00282988 predicted 289
2 SASI_Hs01_00282989 predicted 691
3 SASI_Hs01_00282990 predicted 658
4 SASI_Hs01_00282991 predicted 366
5 SASI_Hs01_00282992 predicted 444
6 SASI_Hs01_00282993 predicted 276
7 SASI_Hs01_00282994 predicted 621
8 SASI_Hs01_00282995 predicted 720
9 SASI_Hs01_00282996 predicted 430
10 SASI_Hs01_00282997 predicted 458
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001100917
TSPAN19 MISSION shRNA Bacterial Glycerol Stock
tetraspanin 19
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000253944    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001100917.1-865s21c1
Sequence:CCGGTGTTCAGAAGAAACCAGTTAACTCGAGTTAACTGGTTTCTTCTGAACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000253947    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001100917.1-736s21c1
Sequence:CCGGTGTTAACCTTAATCGGAATTACTCGAGTAATTCCGATTAAGGTTAACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000253948    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001100917.1-192s21c1
Sequence:CCGGTTTGGTGCATGGCTCTTATTACTCGAGTAATAAGAGCCATGCACCAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000253946    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001100917.1-477s21c1
Sequence:CCGGATTTCTGAGTATGGATCTAAACTCGAGTTTAGATCCATACTCAGAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000253945    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001100917.1-250s21c1
Sequence:CCGGATCACTTCATAGTACCTATTTCTCGAGAAATAGGTACTATGAAGTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001100917
TSPAN19 MISSION shRNA shRNA Plasmid DNA
tetraspanin 19
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000253944    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001100917.1-865s21c1
Sequence:CCGGTGTTCAGAAGAAACCAGTTAACTCGAGTTAACTGGTTTCTTCTGAACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000253947    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001100917.1-736s21c1
Sequence:CCGGTGTTAACCTTAATCGGAATTACTCGAGTAATTCCGATTAAGGTTAACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000253948    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001100917.1-192s21c1
Sequence:CCGGTTTGGTGCATGGCTCTTATTACTCGAGTAATAAGAGCCATGCACCAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000253946    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001100917.1-477s21c1
Sequence:CCGGATTTCTGAGTATGGATCTAAACTCGAGTTTAGATCCATACTCAGAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000253945    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001100917.1-250s21c1
Sequence:CCGGATCACTTCATAGTACCTATTTCTCGAGAAATAGGTACTATGAAGTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001100917
TSPAN19 MISSION shRNA Lentiviral Transduction Particles
tetraspanin 19
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000253944    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001100917.1-865s21c1
Sequence:CCGGTGTTCAGAAGAAACCAGTTAACTCGAGTTAACTGGTTTCTTCTGAACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000253947    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001100917.1-736s21c1
Sequence:CCGGTGTTAACCTTAATCGGAATTACTCGAGTAATTCCGATTAAGGTTAACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000253948    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001100917.1-192s21c1
Sequence:CCGGTTTGGTGCATGGCTCTTATTACTCGAGTAATAAGAGCCATGCACCAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000253946    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001100917.1-477s21c1
Sequence:CCGGATTTCTGAGTATGGATCTAAACTCGAGTTTAGATCCATACTCAGAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000253945    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001100917.1-250s21c1
Sequence:CCGGATCACTTCATAGTACCTATTTCTCGAGAAATAGGTACTATGAAGTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks