EMAIL THIS PAGE TO A FRIEND

TSPAN1

tetraspanin 1

Synonyms: NET1 TM4C TM4SF
UniProtKB ID: O60635, D3DQ14, O60745, Q5VST0
Gene ID:
Human(10103) Summary: The protein encoded by this gene is a member of the transmembrane 4 superfamily, also known as the tetraspanin family. Most of these members are cell-surface proteins that are characterized by the presence of four hydrophobic domains. The proteins mediate signal transduction events that play a role in the regulation of cell development, activation, growth and motility. [provided by RefSeq, Jul 2008]
Mouse(66805) tetraspanin 1
Rat(298436) tetraspanin 1
chicken(424607) tetraspanin 1
dog(475370) tetraspanin 1
domestic cat(101093789) tetraspanin 1
cow(506550) tetraspanin 1
sheep(101101845) tetraspanin 1
52 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_005727 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005727 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005727 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_133681 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_133681 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_133681 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005727 Rosetta Predictions human pricing
NM_001004236 Rosetta Predictions rat pricing
NM_133681 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005727 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00241056 predicted 308
2 SASI_Hs01_00241057 predicted 431
3 SASI_Hs01_00241058 predicted 462
4 SASI_Hs01_00241059 predicted 205
5 SASI_Hs01_00241060 predicted 596
6 SASI_Hs01_00241061 predicted 489
7 SASI_Hs01_00241063 predicted 824
8 SASI_Hs01_00241064 predicted 343
9 SASI_Hs01_00241065 predicted 822
10 SASI_Hs02_00340157 predicted 874
11 SASI_Hs01_00241062 predicted 808
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001004236 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00117807 predicted 503
2 SASI_Rn01_00117808 predicted 818
3 SASI_Rn01_00117809 predicted 568
4 SASI_Rn02_00198239 predicted 868
5 SASI_Rn01_00117810 predicted 507
6 SASI_Rn01_00117811 predicted 659
7 SASI_Rn02_00198240 predicted 724
8 SASI_Rn01_00117812 predicted 360
9 SASI_Rn01_00117815 predicted 521
10 SASI_Rn01_00117816 predicted 454
11 SASI_Rn01_00117813 predicted 948
12 SASI_Rn01_00117814 predicted 653
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133681 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00338641 predicted 576
2 SASI_Mm01_00174538 predicted 439
3 SASI_Mm01_00174539 predicted 743
4 SASI_Mm01_00174540 predicted 355
5 SASI_Mm01_00174541 predicted 543
6 SASI_Mm01_00174542 predicted 540
7 SASI_Mm01_00174543 predicted 525
8 SASI_Mm01_00174544 predicted 574
9 SASI_Mm01_00174545 predicted 218
10 SASI_Mm01_00174547 predicted 377
11 SASI_Mm01_00174546 predicted 485
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005727
TSPAN1 MISSION shRNA Bacterial Glycerol Stock
tetraspanin 1
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000119157    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005727.2-1112s1c1
Sequence:CCGGCCAGTCTATTAAACCCTTGATCTCGAGATCAAGGGTTTAATAGACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000119158    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005727.2-163s1c1
Sequence:CCGGCCTCTTCAATTTGCTCATCTTCTCGAGAAGATGAGCAAATTGAAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000119160    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005727.2-500s1c1
Sequence:CCGGGCCATCAAGAAAGATTATGGTCTCGAGACCATAATCTTTCTTGATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000119159    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005727.2-501s1c1
Sequence:CCGGCCATCAAGAAAGATTATGGTTCTCGAGAACCATAATCTTTCTTGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000382241    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005727.2-1019s21c1
Sequence:GTACCGGTTTAGGCGATGCCTGACTTTCCTCGAGGAAAGTCAGGCATCGCCTAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000379441    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005727.2-812s21c1
Sequence:GTACCGGGCCATGATTGTGTCCATGTATCTCGAGATACATGGACACAATCATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000381051    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005727.2-282s21c1
Sequence:GTACCGGAGTTTGTCAACGTGGGCTACTCTCGAGAGTAGCCCACGTTGACAAACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000382032    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005727.2-573s21c1
Sequence:GTACCGGGCTGTGGCTTCACCAACTATACTCGAGTATAGTTGGTGAAGCCACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000381864    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005727.2-543s21c1
Sequence:GTACCGGTGTGGAACACCACCATGAAAGCTCGAGCTTTCATGGTGGTGTTCCACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005727
TSPAN1 MISSION shRNA shRNA Plasmid DNA
tetraspanin 1
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000119157    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005727.2-1112s1c1
Sequence:CCGGCCAGTCTATTAAACCCTTGATCTCGAGATCAAGGGTTTAATAGACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000119158    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005727.2-163s1c1
Sequence:CCGGCCTCTTCAATTTGCTCATCTTCTCGAGAAGATGAGCAAATTGAAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000119160    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005727.2-500s1c1
Sequence:CCGGGCCATCAAGAAAGATTATGGTCTCGAGACCATAATCTTTCTTGATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000119159    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005727.2-501s1c1
Sequence:CCGGCCATCAAGAAAGATTATGGTTCTCGAGAACCATAATCTTTCTTGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000382241    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005727.2-1019s21c1
Sequence:GTACCGGTTTAGGCGATGCCTGACTTTCCTCGAGGAAAGTCAGGCATCGCCTAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000379441    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005727.2-812s21c1
Sequence:GTACCGGGCCATGATTGTGTCCATGTATCTCGAGATACATGGACACAATCATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000381051    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005727.2-282s21c1
Sequence:GTACCGGAGTTTGTCAACGTGGGCTACTCTCGAGAGTAGCCCACGTTGACAAACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000382032    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005727.2-573s21c1
Sequence:GTACCGGGCTGTGGCTTCACCAACTATACTCGAGTATAGTTGGTGAAGCCACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000381864    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005727.2-543s21c1
Sequence:GTACCGGTGTGGAACACCACCATGAAAGCTCGAGCTTTCATGGTGGTGTTCCACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005727
TSPAN1 MISSION shRNA Lentiviral Transduction Particles
tetraspanin 1
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000119157    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005727.2-1112s1c1
Sequence:CCGGCCAGTCTATTAAACCCTTGATCTCGAGATCAAGGGTTTAATAGACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000119158    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005727.2-163s1c1
Sequence:CCGGCCTCTTCAATTTGCTCATCTTCTCGAGAAGATGAGCAAATTGAAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000119160    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005727.2-500s1c1
Sequence:CCGGGCCATCAAGAAAGATTATGGTCTCGAGACCATAATCTTTCTTGATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000119159    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005727.2-501s1c1
Sequence:CCGGCCATCAAGAAAGATTATGGTTCTCGAGAACCATAATCTTTCTTGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000382241    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005727.2-1019s21c1
Sequence:GTACCGGTTTAGGCGATGCCTGACTTTCCTCGAGGAAAGTCAGGCATCGCCTAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000379441    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005727.2-812s21c1
Sequence:GTACCGGGCCATGATTGTGTCCATGTATCTCGAGATACATGGACACAATCATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000381051    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005727.2-282s21c1
Sequence:GTACCGGAGTTTGTCAACGTGGGCTACTCTCGAGAGTAGCCCACGTTGACAAACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000382032    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005727.2-573s21c1
Sequence:GTACCGGGCTGTGGCTTCACCAACTATACTCGAGTATAGTTGGTGAAGCCACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000381864    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005727.2-543s21c1
Sequence:GTACCGGTGTGGAACACCACCATGAAAGCTCGAGCTTTCATGGTGGTGTTCCACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_133681
TSPAN1 MISSION shRNA Bacterial Glycerol Stock
tetraspanin 1
Mouse
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000095012    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133681.2-179s1c1
Sequence:CCGGCTCTTCAATCTACTCATCTTTCTCGAGAAAGATGAGTAGATTGAAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000095013    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133681.2-553s1c1
Sequence:CCGGCCAAGTATGGAACACTACAATCTCGAGATTGTAGTGTTCCATACTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000095011    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133681.2-824s1c1
Sequence:CCGGGCCATGGTTGTATCCATGTATCTCGAGATACATGGATACAACCATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000095010    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133681.2-626s1c1
Sequence:CCGGCGTTTCGTCAAAGAGAATAAACTCGAGTTTATTCTCTTTGACGAAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000095009    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_133681.2-1751s1c1
Sequence:CCGGCGGGTATGTTTCCATCATCTTCTCGAGAAGATGATGGAAACATACCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000381264    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_133681.4-960s21c1
Sequence:GTACCGGCATTTGGGCTGGAATGGATTTCTCGAGAAATCCATTCCAGCCCAAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000381056    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_133681.4-991s21c1
Sequence:GTACCGGCTCAGGGACTTTGGGCTAAATCTCGAGATTTAGCCCAAAGTCCCTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000380465    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133681.4-721s21c1
Sequence:GTACCGGATGAAAGTACAGGGTTGTTTCCTCGAGGAAACAACCCTGTACTTTCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000379487    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133681.4-528s21c1
Sequence:GTACCGGCTATGGTTACCAGACTGATTTCTCGAGAAATCAGTCTGGTAACCATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000380250    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133681.4-261s21c1
Sequence:GTACCGGGAAGGTCTTCGGATCACTATCCTCGAGGATAGTGATCCGAAGACCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000380932    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133681.4-238s21c1
Sequence:GTACCGGTCCGTCGATGGGACATCTTTCCTCGAGGAAAGATGTCCCATCGACGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000381483    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133681.4-617s21c1
Sequence:GTACCGGATGCCTCACGTTTCGTCAAAGCTCGAGCTTTGACGAAACGTGAGGCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000382177    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133681.4-828s21c1
Sequence:GTACCGGGGTTGTATCCATGTATCTATACTCGAGTATAGATACATGGATACAACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_133681
TSPAN1 MISSION shRNA shRNA Plasmid DNA
tetraspanin 1
Mouse
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000095012    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133681.2-179s1c1
Sequence:CCGGCTCTTCAATCTACTCATCTTTCTCGAGAAAGATGAGTAGATTGAAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000095013    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133681.2-553s1c1
Sequence:CCGGCCAAGTATGGAACACTACAATCTCGAGATTGTAGTGTTCCATACTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000095011    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133681.2-824s1c1
Sequence:CCGGGCCATGGTTGTATCCATGTATCTCGAGATACATGGATACAACCATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000095010    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133681.2-626s1c1
Sequence:CCGGCGTTTCGTCAAAGAGAATAAACTCGAGTTTATTCTCTTTGACGAAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000095009    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_133681.2-1751s1c1
Sequence:CCGGCGGGTATGTTTCCATCATCTTCTCGAGAAGATGATGGAAACATACCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000381264    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_133681.4-960s21c1
Sequence:GTACCGGCATTTGGGCTGGAATGGATTTCTCGAGAAATCCATTCCAGCCCAAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000381056    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_133681.4-991s21c1
Sequence:GTACCGGCTCAGGGACTTTGGGCTAAATCTCGAGATTTAGCCCAAAGTCCCTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000380465    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133681.4-721s21c1
Sequence:GTACCGGATGAAAGTACAGGGTTGTTTCCTCGAGGAAACAACCCTGTACTTTCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000379487    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133681.4-528s21c1
Sequence:GTACCGGCTATGGTTACCAGACTGATTTCTCGAGAAATCAGTCTGGTAACCATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000380250    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133681.4-261s21c1
Sequence:GTACCGGGAAGGTCTTCGGATCACTATCCTCGAGGATAGTGATCCGAAGACCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000380932    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133681.4-238s21c1
Sequence:GTACCGGTCCGTCGATGGGACATCTTTCCTCGAGGAAAGATGTCCCATCGACGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000381483    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133681.4-617s21c1
Sequence:GTACCGGATGCCTCACGTTTCGTCAAAGCTCGAGCTTTGACGAAACGTGAGGCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000382177    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133681.4-828s21c1
Sequence:GTACCGGGGTTGTATCCATGTATCTATACTCGAGTATAGATACATGGATACAACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_133681
TSPAN1 MISSION shRNA Lentiviral Transduction Particles
tetraspanin 1
Mouse
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000095012    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133681.2-179s1c1
Sequence:CCGGCTCTTCAATCTACTCATCTTTCTCGAGAAAGATGAGTAGATTGAAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000095013    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133681.2-553s1c1
Sequence:CCGGCCAAGTATGGAACACTACAATCTCGAGATTGTAGTGTTCCATACTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000095011    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133681.2-824s1c1
Sequence:CCGGGCCATGGTTGTATCCATGTATCTCGAGATACATGGATACAACCATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000095010    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133681.2-626s1c1
Sequence:CCGGCGTTTCGTCAAAGAGAATAAACTCGAGTTTATTCTCTTTGACGAAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000095009    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_133681.2-1751s1c1
Sequence:CCGGCGGGTATGTTTCCATCATCTTCTCGAGAAGATGATGGAAACATACCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000381264    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_133681.4-960s21c1
Sequence:GTACCGGCATTTGGGCTGGAATGGATTTCTCGAGAAATCCATTCCAGCCCAAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000381056    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_133681.4-991s21c1
Sequence:GTACCGGCTCAGGGACTTTGGGCTAAATCTCGAGATTTAGCCCAAAGTCCCTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000380465    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133681.4-721s21c1
Sequence:GTACCGGATGAAAGTACAGGGTTGTTTCCTCGAGGAAACAACCCTGTACTTTCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000379487    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133681.4-528s21c1
Sequence:GTACCGGCTATGGTTACCAGACTGATTTCTCGAGAAATCAGTCTGGTAACCATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000380250    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133681.4-261s21c1
Sequence:GTACCGGGAAGGTCTTCGGATCACTATCCTCGAGGATAGTGATCCGAAGACCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000380932    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133681.4-238s21c1
Sequence:GTACCGGTCCGTCGATGGGACATCTTTCCTCGAGGAAAGATGTCCCATCGACGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000381483    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133681.4-617s21c1
Sequence:GTACCGGATGCCTCACGTTTCGTCAAAGCTCGAGCTTTGACGAAACGTGAGGCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000382177    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133681.4-828s21c1
Sequence:GTACCGGGGTTGTATCCATGTATCTATACTCGAGTATAGATACATGGATACAACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks