EMAIL THIS PAGE TO A FRIEND

TSPAN2

tetraspanin 2

Synonyms: NET3 TSN2 TSPAN-2
UniProtKB ID: O60636, Q5TET2, Q8WU05
Gene ID:
Human(10100) Summary: The protein encoded by this gene is a member of the transmembrane 4 superfamily, also known as the tetraspanin family. Most of these members are cell-surface proteins that are characterized by the presence of four hydrophobic domains. The proteins mediate signal transduction events that play a role in the regulation of cell development, activation, growth and motility. [provided by RefSeq, Jul 2008]
Mouse(70747) tetraspanin 2
Rat(64521) tetraspanin 2
cow(539001) tetraspanin 2
sheep(101109585) tetraspanin 2
Zebrafish(378854) tetraspanin 2
dog(612755) tetraspanin 2
domestic cat(101097627) tetraspanin 2
chicken(419889) tetraspanin 2
140 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_027533 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_027533 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_027533 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_005725 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005725 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005725 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005725 Rosetta Predictions human pricing
NM_022589 Rosetta Predictions rat pricing
NM_027533 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005725 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00113197 predicted 304
2 SASI_Hs01_00113198 predicted 616
3 SASI_Hs02_00340147 predicted 352
4 SASI_Hs01_00113199 predicted 806
5 SASI_Hs01_00113200 predicted 584
6 SASI_Hs01_00113202 predicted 408
7 SASI_Hs01_00113203 predicted 609
8 SASI_Hs01_00113204 predicted 417
9 SASI_Hs01_00113205 predicted 660
10 SASI_Hs01_00113206 predicted 479
11 SASI_Hs01_00113201 predicted 554
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022589 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00107197 predicted 533
2 SASI_Rn01_00107198 predicted 790
3 SASI_Rn01_00107199 predicted 335
4 SASI_Rn01_00107200 predicted 586
5 SASI_Rn01_00107201 predicted 563
6 SASI_Rn01_00107202 predicted 383
7 SASI_Rn01_00107203 predicted 550
8 SASI_Rn01_00107204 predicted 706
9 SASI_Rn01_00107205 predicted 809
10 SASI_Rn01_00107206 predicted 882
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_027533 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00191363 predicted 880
2 SASI_Mm01_00191364 predicted 785
3 SASI_Mm01_00191365 predicted 917
4 SASI_Mm02_00332372 predicted 514
5 SASI_Mm01_00191366 predicted 736
6 SASI_Mm01_00191367 predicted 890
7 SASI_Mm01_00191368 predicted 570
8 SASI_Mm01_00191369 predicted 790
9 SASI_Mm01_00191370 predicted 300
10 SASI_Mm01_00191371 predicted 823
11 SASI_Mm01_00191372 predicted 780
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_027533
VALIDATED
TSPAN2 MISSION shRNA Bacterial Glycerol Stock
tetraspanin 2
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000354222    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027533.2-428s21c1
Sequence:CCGGCCTGATGATGACTGTGGGTTTCTCGAGAAACCCACAGTCATCATCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000326866    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_027533.2-3037s21c1
Sequence:CCGGCCCGTTTGAAACTATGGAGATCTCGAGATCTCCATAGTTTCAAACGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000326800    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027533.2-822s21c1
Sequence:CCGGCTCACGATCTTTGGCATGATACTCGAGTATCATGCCAAAGATCGTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000326867    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027533.2-310s21c1
Sequence:CCGGCCGTTATTGCATTTGGACTATCTCGAGATAGTCCAAATGCAATAACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000326864    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027533.2-538s21c1
Sequence:CCGGCCACTGGAGTATTTGCATTTACTCGAGTAAATGCAAATACTCCAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000094469    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_027533.2-3037s1c1
Sequence:CCGGCCCGTTTGAAACTATGGAGATCTCGAGATCTCCATAGTTTCAAACGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000094471    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027533.2-538s1c1
Sequence:CCGGCCACTGGAGTATTTGCATTTACTCGAGTAAATGCAAATACTCCAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000094473    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027533.2-822s1c1
Sequence:CCGGCTCACGATCTTTGGCATGATACTCGAGTATCATGCCAAAGATCGTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000094472    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027533.2-310s1c1
Sequence:CCGGCCGTTATTGCATTTGGACTATCTCGAGATAGTCCAAATGCAATAACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000094470    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027533.2-428s1c1
Sequence:CCGGCCTGATGATGACTGTGGGTTTCTCGAGAAACCCACAGTCATCATCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_027533
VALIDATED
TSPAN2 MISSION shRNA shRNA Plasmid DNA
tetraspanin 2
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000354222    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027533.2-428s21c1
Sequence:CCGGCCTGATGATGACTGTGGGTTTCTCGAGAAACCCACAGTCATCATCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000326866    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_027533.2-3037s21c1
Sequence:CCGGCCCGTTTGAAACTATGGAGATCTCGAGATCTCCATAGTTTCAAACGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000326800    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027533.2-822s21c1
Sequence:CCGGCTCACGATCTTTGGCATGATACTCGAGTATCATGCCAAAGATCGTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000326867    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027533.2-310s21c1
Sequence:CCGGCCGTTATTGCATTTGGACTATCTCGAGATAGTCCAAATGCAATAACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000326864    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027533.2-538s21c1
Sequence:CCGGCCACTGGAGTATTTGCATTTACTCGAGTAAATGCAAATACTCCAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000094469    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_027533.2-3037s1c1
Sequence:CCGGCCCGTTTGAAACTATGGAGATCTCGAGATCTCCATAGTTTCAAACGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000094471    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027533.2-538s1c1
Sequence:CCGGCCACTGGAGTATTTGCATTTACTCGAGTAAATGCAAATACTCCAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000094473    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027533.2-822s1c1
Sequence:CCGGCTCACGATCTTTGGCATGATACTCGAGTATCATGCCAAAGATCGTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000094472    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027533.2-310s1c1
Sequence:CCGGCCGTTATTGCATTTGGACTATCTCGAGATAGTCCAAATGCAATAACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000094470    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027533.2-428s1c1
Sequence:CCGGCCTGATGATGACTGTGGGTTTCTCGAGAAACCCACAGTCATCATCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_027533
VALIDATED
TSPAN2 MISSION shRNA Lentiviral Transduction Particles
tetraspanin 2
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000354222    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027533.2-428s21c1
Sequence:CCGGCCTGATGATGACTGTGGGTTTCTCGAGAAACCCACAGTCATCATCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000326866    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_027533.2-3037s21c1
Sequence:CCGGCCCGTTTGAAACTATGGAGATCTCGAGATCTCCATAGTTTCAAACGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000326800    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027533.2-822s21c1
Sequence:CCGGCTCACGATCTTTGGCATGATACTCGAGTATCATGCCAAAGATCGTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000326867    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027533.2-310s21c1
Sequence:CCGGCCGTTATTGCATTTGGACTATCTCGAGATAGTCCAAATGCAATAACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000326864    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027533.2-538s21c1
Sequence:CCGGCCACTGGAGTATTTGCATTTACTCGAGTAAATGCAAATACTCCAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000094469    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_027533.2-3037s1c1
Sequence:CCGGCCCGTTTGAAACTATGGAGATCTCGAGATCTCCATAGTTTCAAACGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000094471    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027533.2-538s1c1
Sequence:CCGGCCACTGGAGTATTTGCATTTACTCGAGTAAATGCAAATACTCCAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000094473    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027533.2-822s1c1
Sequence:CCGGCTCACGATCTTTGGCATGATACTCGAGTATCATGCCAAAGATCGTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000094472    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027533.2-310s1c1
Sequence:CCGGCCGTTATTGCATTTGGACTATCTCGAGATAGTCCAAATGCAATAACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000094470    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027533.2-428s1c1
Sequence:CCGGCCTGATGATGACTGTGGGTTTCTCGAGAAACCCACAGTCATCATCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005725
VALIDATED
TSPAN2 MISSION shRNA Bacterial Glycerol Stock
tetraspanin 2
Human
14 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000244845    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_005725.3-575s21c1
Sequence:CCGGCAAGAATTGCATCGATGAAATCTCGAGATTTCATCGATGCAATTCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000244847    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005725.3-2828s21c1
Sequence:CCGGCCACTAAGCAACAATAGATTTCTCGAGAAATCTATTGTTGCTTAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000244846    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_005725.3-659s21c1
Sequence:CCGGGACGATCTTTGGCATGATATTCTCGAGAATATCATGCCAAAGATCGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000244844    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_005725.3-489s21c1
Sequence:CCGGATCACCTTCCACTCAACATTTCTCGAGAAATGTTGAGTGGAAGGTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000244843    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_005725.3-315s21c1
Sequence:CCGGCAATGTGTGCTTGGATCATTTCTCGAGAAATGATCCAAGCACACATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000153441    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_005725.2-463s1c1
Sequence:CCGGCCTTCCACTCAACATTTCAGTCTCGAGACTGAAATGTTGAGTGGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000152007    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_005725.2-635s1c1
Sequence:CCGGCTTTGGCATGATATTCAGCATCTCGAGATGCTGAATATCATGCCAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000152521    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005725.2-148s1c1
Sequence:CCGGGAGGTGCCATAAAGGAGTTATCTCGAGATAACTCCTTTATGGCACCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000152791    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005725.2-395s1c1
Sequence:CCGGGACCATGTATGAAGAGGCTTACTCGAGTAAGCCTCTTCATACATGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000152688    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A3
TRC Version: 1 Clone ID:NM_005725.2-593s1c1
Sequence:CCGGGCTCATTGGAATTGTCGGTATCTCGAGATACCGACAATTCCAATGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000151095    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005725.2-408s1c1
Sequence:CCGGGAGGCTTACAATGATTACCTTCTCGAGAAGGTAATCATTGTAAGCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000150915    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_005725.2-676s1c1
Sequence:CCGGGAAACTCACGAGATGTGATATCTCGAGATATCACATCTCGTGAGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000158094    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005725.2-446s1c1
Sequence:CCGGCAATGGGACACTCATCACCTTCTCGAGAAGGTGATGAGTGTCCCATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000157069    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A3
TRC Version: 1 Clone ID:NM_005725.2-333s1c1
Sequence:CCGGGCTGAAGTAACCACTGGAGTACTCGAGTACTCCAGTGGTTACTTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005725
VALIDATED
TSPAN2 MISSION shRNA shRNA Plasmid DNA
tetraspanin 2
Human
14 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000244845    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_005725.3-575s21c1
Sequence:CCGGCAAGAATTGCATCGATGAAATCTCGAGATTTCATCGATGCAATTCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000244847    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005725.3-2828s21c1
Sequence:CCGGCCACTAAGCAACAATAGATTTCTCGAGAAATCTATTGTTGCTTAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000244846    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_005725.3-659s21c1
Sequence:CCGGGACGATCTTTGGCATGATATTCTCGAGAATATCATGCCAAAGATCGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000244844    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_005725.3-489s21c1
Sequence:CCGGATCACCTTCCACTCAACATTTCTCGAGAAATGTTGAGTGGAAGGTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000244843    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_005725.3-315s21c1
Sequence:CCGGCAATGTGTGCTTGGATCATTTCTCGAGAAATGATCCAAGCACACATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000153441    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_005725.2-463s1c1
Sequence:CCGGCCTTCCACTCAACATTTCAGTCTCGAGACTGAAATGTTGAGTGGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000152007    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_005725.2-635s1c1
Sequence:CCGGCTTTGGCATGATATTCAGCATCTCGAGATGCTGAATATCATGCCAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000152521    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005725.2-148s1c1
Sequence:CCGGGAGGTGCCATAAAGGAGTTATCTCGAGATAACTCCTTTATGGCACCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000152791    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005725.2-395s1c1
Sequence:CCGGGACCATGTATGAAGAGGCTTACTCGAGTAAGCCTCTTCATACATGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000152688    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A3
TRC Version: 1 Clone ID:NM_005725.2-593s1c1
Sequence:CCGGGCTCATTGGAATTGTCGGTATCTCGAGATACCGACAATTCCAATGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000151095    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005725.2-408s1c1
Sequence:CCGGGAGGCTTACAATGATTACCTTCTCGAGAAGGTAATCATTGTAAGCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000150915    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_005725.2-676s1c1
Sequence:CCGGGAAACTCACGAGATGTGATATCTCGAGATATCACATCTCGTGAGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000158094    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005725.2-446s1c1
Sequence:CCGGCAATGGGACACTCATCACCTTCTCGAGAAGGTGATGAGTGTCCCATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000157069    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A3
TRC Version: 1 Clone ID:NM_005725.2-333s1c1
Sequence:CCGGGCTGAAGTAACCACTGGAGTACTCGAGTACTCCAGTGGTTACTTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005725
VALIDATED
TSPAN2 MISSION shRNA Lentiviral Transduction Particles
tetraspanin 2
Human
14 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000244845    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_005725.3-575s21c1
Sequence:CCGGCAAGAATTGCATCGATGAAATCTCGAGATTTCATCGATGCAATTCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000244847    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005725.3-2828s21c1
Sequence:CCGGCCACTAAGCAACAATAGATTTCTCGAGAAATCTATTGTTGCTTAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000244846    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_005725.3-659s21c1
Sequence:CCGGGACGATCTTTGGCATGATATTCTCGAGAATATCATGCCAAAGATCGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000244844    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_005725.3-489s21c1
Sequence:CCGGATCACCTTCCACTCAACATTTCTCGAGAAATGTTGAGTGGAAGGTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000244843    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_005725.3-315s21c1
Sequence:CCGGCAATGTGTGCTTGGATCATTTCTCGAGAAATGATCCAAGCACACATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000153441    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_005725.2-463s1c1
Sequence:CCGGCCTTCCACTCAACATTTCAGTCTCGAGACTGAAATGTTGAGTGGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000152007    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_005725.2-635s1c1
Sequence:CCGGCTTTGGCATGATATTCAGCATCTCGAGATGCTGAATATCATGCCAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000152521    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005725.2-148s1c1
Sequence:CCGGGAGGTGCCATAAAGGAGTTATCTCGAGATAACTCCTTTATGGCACCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000152791    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005725.2-395s1c1
Sequence:CCGGGACCATGTATGAAGAGGCTTACTCGAGTAAGCCTCTTCATACATGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000152688    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A3
TRC Version: 1 Clone ID:NM_005725.2-593s1c1
Sequence:CCGGGCTCATTGGAATTGTCGGTATCTCGAGATACCGACAATTCCAATGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000151095    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005725.2-408s1c1
Sequence:CCGGGAGGCTTACAATGATTACCTTCTCGAGAAGGTAATCATTGTAAGCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000150915    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_005725.2-676s1c1
Sequence:CCGGGAAACTCACGAGATGTGATATCTCGAGATATCACATCTCGTGAGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000158094    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005725.2-446s1c1
Sequence:CCGGCAATGGGACACTCATCACCTTCTCGAGAAGGTGATGAGTGTCCCATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000157069    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A3
TRC Version: 1 Clone ID:NM_005725.2-333s1c1
Sequence:CCGGGCTGAAGTAACCACTGGAGTACTCGAGTACTCCAGTGGTTACTTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks