EMAIL THIS PAGE TO A FRIEND

TSPAN31

tetraspanin 31

Synonyms: SAS
UniProtKB ID: Q12999, O00577, Q53X76
Gene ID:
Human(6302) Summary: The protein encoded by this gene is a member of the transmembrane 4 superfamily, also known as the tetraspanin family. Most of these members are cell-surface proteins that are characterized by the presence of four hydrophobic domains. The proteins mediate signal transduction events that play a role in the regulation of cell development, activation, growth and motility. This encoded protein is thought to be involved in growth-related cellular processes. This gene is associated with tumorigenesis and osteosarcoma. [provided by RefSeq, Jul 2008]
Mouse(67125) tetraspanin 31
Rat(362890) tetraspanin 31
cow(510619) tetraspanin 31
sheep(101116467) tetraspanin 31
naked mole-rat(101701577) tetraspanin 31
domestic cat(101097655) tetraspanin 31
dog(403676) tetraspanin 31
48 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_005981 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005981 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005981 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_025982 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_025982 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_025982 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005981 Rosetta Predictions human pricing
NM_001008378 Rosetta Predictions rat pricing
NM_025982 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005981 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00011479 predicted 274
2 SASI_Hs01_00011480 predicted 845
3 SASI_Hs01_00011481 predicted 781
4 SASI_Hs01_00011482 predicted 723
5 SASI_Hs01_00011483 predicted 562
6 SASI_Hs02_00340667 predicted 556
7 SASI_Hs02_00340668 predicted 726
8 SASI_Hs01_00011485 predicted 216
9 SASI_Hs02_00340669 predicted 437
10 SASI_Hs01_00011486 predicted 500
11 SASI_Hs01_00011478 predicted 307
12 SASI_Hs01_00011484 predicted 301
13 SASI_Hs01_00011487 predicted 742
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001008378 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00102403 predicted 593
2 SASI_Rn01_00102404 predicted 667
3 SASI_Rn01_00102405 predicted 665
4 SASI_Rn01_00102406 predicted 969
5 SASI_Rn01_00102408 predicted 993
6 SASI_Rn01_00102409 predicted 232
7 SASI_Rn01_00102410 predicted 447
8 SASI_Rn01_00102411 predicted 859
9 SASI_Rn01_00102412 predicted 695
10 SASI_Rn02_00199154 predicted 656
11 SASI_Rn01_00102407 predicted 219
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025982 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00329415 predicted 364
2 SASI_Mm02_00329416 predicted 609
3 SASI_Mm02_00329417 predicted 637
4 SASI_Mm02_00329418 predicted 561
5 SASI_Mm02_00329419 predicted 199
6 SASI_Mm02_00329420 predicted 209
7 SASI_Mm02_00329421 predicted 544
8 SASI_Mm02_00329422 predicted 220
9 SASI_Mm02_00329423 predicted 387
10 SASI_Mm02_00329424 predicted 287
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005981
VALIDATED
TSPAN31 MISSION shRNA Bacterial Glycerol Stock
tetraspanin 31
Human
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000379943    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 2 Clone ID:NM_005981.3-433s21c1
Sequence:GTACCGGTTGCTCATGTCTGGCTATTAACTCGAGTTAATAGCCAGACATGAGCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000278889    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005981.3-561s21c1
Sequence:CCGGCAACCCTGTATCAACAAGATTCTCGAGAATCTTGTTGATACAGGGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000278964    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005981.3-952s21c1
Sequence:CCGGTTAGTGGGAGCCAGACTATAACTCGAGTTATAGTCTGGCTCCCACTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000278963    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_005981.3-285s21c1
Sequence:CCGGACATCATCGGCGGAGTCATTGCTCGAGCAATGACTCCGCCGATGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000278962    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005981.3-727s21c1
Sequence:CCGGGCTAGCAATGAGATTTCGGAACTCGAGTTCCGAAATCTCATTGCTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000297590    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_005981.3-397s21c1
Sequence:CCGGCCTTGGTTTGGTCTTCATCTTCTCGAGAAGATGAAGACCAAACCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000155919    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_005981.3-397s1c1
Sequence:CCGGCCTTGGTTTGGTCTTCATCTTCTCGAGAAGATGAAGACCAAACCAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000155037    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_005981.3-727s1c1
Sequence:CCGGGCTAGCAATGAGATTTCGGAACTCGAGTTCCGAAATCTCATTGCTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000152101    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_005981.3-561s1c1
Sequence:CCGGCAACCCTGTATCAACAAGATTCTCGAGAATCTTGTTGATACAGGGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000155757    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005981.3-443s1c1
Sequence:CCGGCTGGCTATTAACCGAAGCAAACTCGAGTTTGCTTCGGTTAATAGCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000158399    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005981.3-478s1c1
Sequence:CCGGCAATGCTTCTTGGTGGGTCATCTCGAGATGACCCACCAAGAAGCATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000158013    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005981.3-621s1c1
Sequence:CCGGCATGCCAGATGTGTGGAGAAACTCGAGTTTCTCCACACATCTGGCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000158113    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005981.3-743s1c1
Sequence:CCGGCGGAATCAGAAGGATCCTAGACTCGAGTCTAGGATCCTTCTGATTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005981
VALIDATED
TSPAN31 MISSION shRNA shRNA Plasmid DNA
tetraspanin 31
Human
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000379943    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 2 Clone ID:NM_005981.3-433s21c1
Sequence:GTACCGGTTGCTCATGTCTGGCTATTAACTCGAGTTAATAGCCAGACATGAGCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000278889    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005981.3-561s21c1
Sequence:CCGGCAACCCTGTATCAACAAGATTCTCGAGAATCTTGTTGATACAGGGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000278964    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005981.3-952s21c1
Sequence:CCGGTTAGTGGGAGCCAGACTATAACTCGAGTTATAGTCTGGCTCCCACTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000278963    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_005981.3-285s21c1
Sequence:CCGGACATCATCGGCGGAGTCATTGCTCGAGCAATGACTCCGCCGATGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000278962    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005981.3-727s21c1
Sequence:CCGGGCTAGCAATGAGATTTCGGAACTCGAGTTCCGAAATCTCATTGCTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000297590    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_005981.3-397s21c1
Sequence:CCGGCCTTGGTTTGGTCTTCATCTTCTCGAGAAGATGAAGACCAAACCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000155919    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_005981.3-397s1c1
Sequence:CCGGCCTTGGTTTGGTCTTCATCTTCTCGAGAAGATGAAGACCAAACCAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000155037    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_005981.3-727s1c1
Sequence:CCGGGCTAGCAATGAGATTTCGGAACTCGAGTTCCGAAATCTCATTGCTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000152101    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_005981.3-561s1c1
Sequence:CCGGCAACCCTGTATCAACAAGATTCTCGAGAATCTTGTTGATACAGGGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000155757    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005981.3-443s1c1
Sequence:CCGGCTGGCTATTAACCGAAGCAAACTCGAGTTTGCTTCGGTTAATAGCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000158399    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005981.3-478s1c1
Sequence:CCGGCAATGCTTCTTGGTGGGTCATCTCGAGATGACCCACCAAGAAGCATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000158013    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005981.3-621s1c1
Sequence:CCGGCATGCCAGATGTGTGGAGAAACTCGAGTTTCTCCACACATCTGGCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000158113    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005981.3-743s1c1
Sequence:CCGGCGGAATCAGAAGGATCCTAGACTCGAGTCTAGGATCCTTCTGATTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005981
VALIDATED
TSPAN31 MISSION shRNA Lentiviral Transduction Particles
tetraspanin 31
Human
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000379943    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 2 Clone ID:NM_005981.3-433s21c1
Sequence:GTACCGGTTGCTCATGTCTGGCTATTAACTCGAGTTAATAGCCAGACATGAGCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000278889    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005981.3-561s21c1
Sequence:CCGGCAACCCTGTATCAACAAGATTCTCGAGAATCTTGTTGATACAGGGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000278964    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005981.3-952s21c1
Sequence:CCGGTTAGTGGGAGCCAGACTATAACTCGAGTTATAGTCTGGCTCCCACTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000278963    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_005981.3-285s21c1
Sequence:CCGGACATCATCGGCGGAGTCATTGCTCGAGCAATGACTCCGCCGATGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000278962    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005981.3-727s21c1
Sequence:CCGGGCTAGCAATGAGATTTCGGAACTCGAGTTCCGAAATCTCATTGCTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000297590    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_005981.3-397s21c1
Sequence:CCGGCCTTGGTTTGGTCTTCATCTTCTCGAGAAGATGAAGACCAAACCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000155919    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_005981.3-397s1c1
Sequence:CCGGCCTTGGTTTGGTCTTCATCTTCTCGAGAAGATGAAGACCAAACCAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000155037    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_005981.3-727s1c1
Sequence:CCGGGCTAGCAATGAGATTTCGGAACTCGAGTTCCGAAATCTCATTGCTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000152101    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_005981.3-561s1c1
Sequence:CCGGCAACCCTGTATCAACAAGATTCTCGAGAATCTTGTTGATACAGGGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000155757    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005981.3-443s1c1
Sequence:CCGGCTGGCTATTAACCGAAGCAAACTCGAGTTTGCTTCGGTTAATAGCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000158399    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005981.3-478s1c1
Sequence:CCGGCAATGCTTCTTGGTGGGTCATCTCGAGATGACCCACCAAGAAGCATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000158013    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005981.3-621s1c1
Sequence:CCGGCATGCCAGATGTGTGGAGAAACTCGAGTTTCTCCACACATCTGGCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000158113    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005981.3-743s1c1
Sequence:CCGGCGGAATCAGAAGGATCCTAGACTCGAGTCTAGGATCCTTCTGATTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025982
VALIDATED
TSPAN31 MISSION shRNA Bacterial Glycerol Stock
tetraspanin 31
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000353383    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025982.4-616s21c1
Sequence:CCGGGTTGGGCTCTTCTTTAGTTTCCTCGAGGAAACTAAAGAAGAGCCCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000336292    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025982.4-123s21c1
Sequence:CCGGGTGCGCTCTCAACGTGGTTTACTCGAGTAAACCACGTTGAGAGCGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000336291    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025982.4-363s21c1
Sequence:CCGGTTGCTCATGTCTGGCTATTAACTCGAGTTAATAGCCAGACATGAGCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000336290    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025982.4-1336s21c1
Sequence:CCGGCCAGTGAACTTAGAAACTAAACTCGAGTTTAGTTTCTAAGTTCACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000353382    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025982.4-194s21c1
Sequence:CCGGTCGGTGTGGTGTCTAGCATTCCTCGAGGAATGCTAGACACCACACCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000120872    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025982.1-1337s1c1
Sequence:CCGGCCAGTGAACTTAGAAACTAAACTCGAGTTTAGTTTCTAAGTTCACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000120876    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025982.1-501s1c1
Sequence:CCGGGCCTACAAGATGATACTTCCTCTCGAGAGGAAGTATCATCTTGTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000120874    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025982.1-658s1c1
Sequence:CCGGGCTAGCAATGAGATTCCGGAACTCGAGTTCCGGAATCTCATTGCTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000120873    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025982.1-441s1c1
Sequence:CCGGCCCGGCATGAACTGGAGAGAACTCGAGTTCTCTCCAGTTCATGCCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025982
VALIDATED
TSPAN31 MISSION shRNA shRNA Plasmid DNA
tetraspanin 31
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000353383    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025982.4-616s21c1
Sequence:CCGGGTTGGGCTCTTCTTTAGTTTCCTCGAGGAAACTAAAGAAGAGCCCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000336292    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025982.4-123s21c1
Sequence:CCGGGTGCGCTCTCAACGTGGTTTACTCGAGTAAACCACGTTGAGAGCGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000336291    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025982.4-363s21c1
Sequence:CCGGTTGCTCATGTCTGGCTATTAACTCGAGTTAATAGCCAGACATGAGCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000336290    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025982.4-1336s21c1
Sequence:CCGGCCAGTGAACTTAGAAACTAAACTCGAGTTTAGTTTCTAAGTTCACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000353382    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025982.4-194s21c1
Sequence:CCGGTCGGTGTGGTGTCTAGCATTCCTCGAGGAATGCTAGACACCACACCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000120872    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025982.1-1337s1c1
Sequence:CCGGCCAGTGAACTTAGAAACTAAACTCGAGTTTAGTTTCTAAGTTCACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000120876    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025982.1-501s1c1
Sequence:CCGGGCCTACAAGATGATACTTCCTCTCGAGAGGAAGTATCATCTTGTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000120874    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025982.1-658s1c1
Sequence:CCGGGCTAGCAATGAGATTCCGGAACTCGAGTTCCGGAATCTCATTGCTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000120873    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025982.1-441s1c1
Sequence:CCGGCCCGGCATGAACTGGAGAGAACTCGAGTTCTCTCCAGTTCATGCCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025982
VALIDATED
TSPAN31 MISSION shRNA Lentiviral Transduction Particles
tetraspanin 31
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000353383    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025982.4-616s21c1
Sequence:CCGGGTTGGGCTCTTCTTTAGTTTCCTCGAGGAAACTAAAGAAGAGCCCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000336292    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025982.4-123s21c1
Sequence:CCGGGTGCGCTCTCAACGTGGTTTACTCGAGTAAACCACGTTGAGAGCGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000336291    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025982.4-363s21c1
Sequence:CCGGTTGCTCATGTCTGGCTATTAACTCGAGTTAATAGCCAGACATGAGCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000336290    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025982.4-1336s21c1
Sequence:CCGGCCAGTGAACTTAGAAACTAAACTCGAGTTTAGTTTCTAAGTTCACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000353382    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025982.4-194s21c1
Sequence:CCGGTCGGTGTGGTGTCTAGCATTCCTCGAGGAATGCTAGACACCACACCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000120872    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025982.1-1337s1c1
Sequence:CCGGCCAGTGAACTTAGAAACTAAACTCGAGTTTAGTTTCTAAGTTCACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000120876    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025982.1-501s1c1
Sequence:CCGGGCCTACAAGATGATACTTCCTCTCGAGAGGAAGTATCATCTTGTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000120874    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025982.1-658s1c1
Sequence:CCGGGCTAGCAATGAGATTCCGGAACTCGAGTTCCGGAATCTCATTGCTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000120873    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025982.1-441s1c1
Sequence:CCGGCCCGGCATGAACTGGAGAGAACTCGAGTTCTCTCCAGTTCATGCCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks