EMAIL THIS PAGE TO A FRIEND

TSPAN32

tetraspanin 32

Synonyms: ART1 PHEMX PHMX TSSC6
UniProtKB ID: Q96QS1, Q96KX4, Q9HC50, Q9HC51, Q9Y5U1
Gene ID:
Human(10077) Summary: This gene, which is a member of the tetraspanin superfamily, is one of several tumor-suppressing subtransferable fragments located in the imprinted gene domain of chromosome 11p15.5, an important tumor-suppressor gene region. Alterations in this region have been associated with Beckwith-Wiedemann syndrome, Wilms tumor, rhabdomyosarcoma, adrenocortical carcinoma, and lung, ovarian and breast cancers. This gene is located among several imprinted genes; however, this gene, as well as the tumor-suppressing subchromosomal transferable fragment 4, escapes imprinting. This gene may play a role in malignancies and diseases that involve this region, and it is also involved in hematopoietic cell function. Alternatively spliced transcript variants have been described, but their biological validity has not been determined. [provided by RefSeq, Jul 2008]
Mouse(27027) tetraspanin 32
Rat(685765) tetraspanin 32
chicken(395087) tetraspanin 32
domestic cat(101093396) tetraspanin 32
dog(483667) tetraspanin 32
naked mole-rat(101722674) tetraspanin 32
cow(530507) tetraspanin 32
sheep(101120369) tetraspanin 32
112 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_005705 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005705 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005705 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_020286 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_020286 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_020286 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_139022 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_139022 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_139022 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005705 Rosetta Predictions human pricing
NM_139022 Rosetta Predictions human pricing
NM_139024 Rosetta Predictions human pricing
XM_001065183 Rosetta Predictions rat pricing
NM_001128080 Rosetta Predictions mouse pricing
NM_001128081 Rosetta Predictions mouse pricing
NM_001128082 Rosetta Predictions mouse pricing
NM_020286 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005705 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00123589 predicted 445
2 SASI_Hs01_00123590 predicted 881
3 SASI_Hs01_00123591 predicted 749
4 SASI_Hs01_00123592 predicted 845
5 SASI_Hs01_00123593 predicted 866
6 SASI_Hs01_00123594 predicted 523
7 SASI_Hs01_00123595 predicted 442
8 SASI_Hs01_00123596 predicted 514
9 SASI_Hs01_00123597 predicted 598
10 SASI_Hs01_00123598 predicted 445
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_139022 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00129356 predicted 505
2 SASI_Hs02_00364063 predicted 677
3 SASI_Hs02_00364064 predicted 508
4 SASI_Hs01_00129365 predicted 570
5 SASI_Hs02_00364065 predicted 653
6 SASI_Hs02_00364066 predicted 508
7 SASI_Hs02_00364067 predicted 596
8 SASI_Hs02_00364068 predicted 424
9 SASI_Hs02_00364069 predicted 529
10 SASI_Hs02_00364070 predicted 522
11 SASI_Hs01_00129357 predicted 948
12 SASI_Hs01_00129358 predicted 823
13 SASI_Hs01_00129359 predicted 913
14 SASI_Hs01_00129360 predicted 930
15 SASI_Hs01_00129361 predicted 221
16 SASI_Hs01_00129362 predicted 178
17 SASI_Hs01_00129363 predicted 589
18 SASI_Hs01_00129364 predicted 149
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_139024 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00090863 predicted 449
2 SASI_Hs01_00090864 predicted 838
3 SASI_Hs01_00090865 predicted 705
4 SASI_Hs01_00090866 predicted 804
5 SASI_Hs01_00090867 predicted 815
6 SASI_Hs01_00090868 predicted 440
7 SASI_Hs01_00090869 predicted 476
8 SASI_Hs01_00090870 predicted 542
9 SASI_Hs01_00090871 predicted 445
10 SASI_Hs01_00090872 predicted 588
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001065183 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00313161 predicted 424
2 SASI_Rn02_00313162 predicted 415
3 SASI_Rn02_00313163 predicted 447
4 SASI_Rn02_00313164 predicted 226
5 SASI_Rn02_00313165 predicted 218
6 SASI_Rn02_00313166 predicted 406
7 SASI_Rn02_00313167 predicted 495
8 SASI_Rn02_00313168 predicted 331
9 SASI_Rn02_00313169 predicted 503
10 SASI_Rn02_00313170 predicted 229
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001128080 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00310418 predicted 1058
2 SASI_Mm02_00310419 predicted 902
3 SASI_Mm02_00310420 predicted 969
4 SASI_Mm02_00310421 predicted 1137
5 SASI_Mm02_00310422 predicted 1145
6 SASI_Mm02_00310423 predicted 899
7 SASI_Mm02_00310424 predicted 1264
8 SASI_Mm02_00310425 predicted 917
9 SASI_Mm02_00310426 predicted 1217
10 SASI_Mm02_00310427 predicted 1235
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001128081 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00310428 predicted 1079
2 SASI_Mm02_00310429 predicted 925
3 SASI_Mm02_00310430 predicted 991
4 SASI_Mm02_00310431 predicted 1155
5 SASI_Mm02_00310432 predicted 1167
6 SASI_Mm02_00310433 predicted 918
7 SASI_Mm02_00310434 predicted 1294
8 SASI_Mm02_00310435 predicted 945
9 SASI_Mm02_00310436 predicted 1242
10 SASI_Mm02_00310437 predicted 1258
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001128082 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00310438 predicted 979
2 SASI_Mm02_00310439 predicted 831
3 SASI_Mm02_00310440 predicted 895
4 SASI_Mm02_00310441 predicted 1059
5 SASI_Mm02_00310442 predicted 1066
6 SASI_Mm02_00310443 predicted 815
7 SASI_Mm02_00310444 predicted 1193
8 SASI_Mm02_00310445 predicted 843
9 SASI_Mm02_00310446 predicted 1144
10 SASI_Mm02_00310447 predicted 1152
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020286 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00325488 predicted 1166
2 SASI_Mm02_00325489 predicted 1009
3 SASI_Mm02_00325490 predicted 1079
4 SASI_Mm02_00325491 predicted 1240
5 SASI_Mm02_00325492 predicted 1250
6 SASI_Mm02_00325493 predicted 1006
7 SASI_Mm02_00325494 predicted 1378
8 SASI_Mm01_00164619 predicted 1025
9 SASI_Mm02_00325495 predicted 1329
10 SASI_Mm02_00325496 predicted 1343
11 SASI_Mm01_00164615 predicted 956
12 SASI_Mm01_00164616 predicted 526
13 SASI_Mm01_00164617 predicted 317
14 SASI_Mm01_00164618 predicted 842
15 SASI_Mm01_00164620 predicted 546
16 SASI_Mm01_00164621 predicted 1175
17 SASI_Mm01_00164622 predicted 817
18 SASI_Mm01_00164623 predicted 1076
19 SASI_Mm01_00164624 predicted 1046
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005705
TSPAN32 MISSION shRNA Bacterial Glycerol Stock
tetraspanin 32
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000179705    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_005705.3-1107s1c1
Sequence:CCGGGTTGACAAGTCAACTCCTCATCTCGAGATGAGGAGTTGACTTGTCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000184796    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005705.3-860s1c1
Sequence:CCGGCACTCCGAAGCAGTTGCTATTCTCGAGAATAGCAACTGCTTCGGAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000155012    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_005705.3-1104s1c1
Sequence:CCGGGCTGTTGACAAGTCAACTCCTCTCGAGAGGAGTTGACTTGTCAACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000153238    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005705.3-458s1c1
Sequence:CCGGGTATATGAGCAGGCGATGAAACTCGAGTTTCATCGCCTGCTCATATACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000154767    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005705.3-869s1c1
Sequence:CCGGGCAGTTGCTATTGGTCCAAGACTCGAGTCTTGGACCAATAGCAACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005705
TSPAN32 MISSION shRNA shRNA Plasmid DNA
tetraspanin 32
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000179705    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_005705.3-1107s1c1
Sequence:CCGGGTTGACAAGTCAACTCCTCATCTCGAGATGAGGAGTTGACTTGTCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000184796    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005705.3-860s1c1
Sequence:CCGGCACTCCGAAGCAGTTGCTATTCTCGAGAATAGCAACTGCTTCGGAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000155012    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_005705.3-1104s1c1
Sequence:CCGGGCTGTTGACAAGTCAACTCCTCTCGAGAGGAGTTGACTTGTCAACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000153238    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005705.3-458s1c1
Sequence:CCGGGTATATGAGCAGGCGATGAAACTCGAGTTTCATCGCCTGCTCATATACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000154767    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005705.3-869s1c1
Sequence:CCGGGCAGTTGCTATTGGTCCAAGACTCGAGTCTTGGACCAATAGCAACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005705
TSPAN32 MISSION shRNA Lentiviral Transduction Particles
tetraspanin 32
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000179705    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_005705.3-1107s1c1
Sequence:CCGGGTTGACAAGTCAACTCCTCATCTCGAGATGAGGAGTTGACTTGTCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000184796    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005705.3-860s1c1
Sequence:CCGGCACTCCGAAGCAGTTGCTATTCTCGAGAATAGCAACTGCTTCGGAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000155012    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_005705.3-1104s1c1
Sequence:CCGGGCTGTTGACAAGTCAACTCCTCTCGAGAGGAGTTGACTTGTCAACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000153238    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005705.3-458s1c1
Sequence:CCGGGTATATGAGCAGGCGATGAAACTCGAGTTTCATCGCCTGCTCATATACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000154767    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005705.3-869s1c1
Sequence:CCGGGCAGTTGCTATTGGTCCAAGACTCGAGTCTTGGACCAATAGCAACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020286
TSPAN32 MISSION shRNA Bacterial Glycerol Stock
tetraspanin 32
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000109820    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020286.2-1037s1c1
Sequence:CCGGGCCCACAGAGATGAAGTCTTTCTCGAGAAAGACTTCATCTCTGTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000109821    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020286.2-520s1c1
Sequence:CCGGGACACCTATGACTTCGTGTATCTCGAGATACACGAAGTCATAGGTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000109823    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020286.2-586s1c1
Sequence:CCGGGCCGTCATCCAGGACACGTTTCTCGAGAAACGTGTCCTGGATGACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000109824    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020286.2-421s1c1
Sequence:CCGGGCTGCGGGTTTCCTGTGCTTTCTCGAGAAAGCACAGGAAACCCGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000109822    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020286.2-718s1c1
Sequence:CCGGCTGTGGACACACTACAGTATTCTCGAGAATACTGTAGTGTGTCCACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000381198    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020286.3-1100s21c1
Sequence:GTACCGGGATCCTCAAAGGAGTAGATAACTCGAGTTATCTACTCCTTTGAGGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000379437    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020286.3-1300s21c1
Sequence:GTACCGGTCTATGGCATCAGGAACATAACTCGAGTTATGTTCCTGATGCCATAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000379552    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020286.3-1333s21c1
Sequence:GTACCGGATGTTGAGGTCAACCAATTTCCTCGAGGAAATTGGTTGACCTCAACATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020286
TSPAN32 MISSION shRNA shRNA Plasmid DNA
tetraspanin 32
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000109820    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020286.2-1037s1c1
Sequence:CCGGGCCCACAGAGATGAAGTCTTTCTCGAGAAAGACTTCATCTCTGTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000109821    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020286.2-520s1c1
Sequence:CCGGGACACCTATGACTTCGTGTATCTCGAGATACACGAAGTCATAGGTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000109823    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020286.2-586s1c1
Sequence:CCGGGCCGTCATCCAGGACACGTTTCTCGAGAAACGTGTCCTGGATGACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000109824    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020286.2-421s1c1
Sequence:CCGGGCTGCGGGTTTCCTGTGCTTTCTCGAGAAAGCACAGGAAACCCGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000109822    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020286.2-718s1c1
Sequence:CCGGCTGTGGACACACTACAGTATTCTCGAGAATACTGTAGTGTGTCCACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000381198    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020286.3-1100s21c1
Sequence:GTACCGGGATCCTCAAAGGAGTAGATAACTCGAGTTATCTACTCCTTTGAGGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000379437    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020286.3-1300s21c1
Sequence:GTACCGGTCTATGGCATCAGGAACATAACTCGAGTTATGTTCCTGATGCCATAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000379552    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020286.3-1333s21c1
Sequence:GTACCGGATGTTGAGGTCAACCAATTTCCTCGAGGAAATTGGTTGACCTCAACATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020286
TSPAN32 MISSION shRNA Lentiviral Transduction Particles
tetraspanin 32
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000109820    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020286.2-1037s1c1
Sequence:CCGGGCCCACAGAGATGAAGTCTTTCTCGAGAAAGACTTCATCTCTGTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000109821    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020286.2-520s1c1
Sequence:CCGGGACACCTATGACTTCGTGTATCTCGAGATACACGAAGTCATAGGTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000109823    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020286.2-586s1c1
Sequence:CCGGGCCGTCATCCAGGACACGTTTCTCGAGAAACGTGTCCTGGATGACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000109824    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020286.2-421s1c1
Sequence:CCGGGCTGCGGGTTTCCTGTGCTTTCTCGAGAAAGCACAGGAAACCCGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000109822    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020286.2-718s1c1
Sequence:CCGGCTGTGGACACACTACAGTATTCTCGAGAATACTGTAGTGTGTCCACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000381198    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020286.3-1100s21c1
Sequence:GTACCGGGATCCTCAAAGGAGTAGATAACTCGAGTTATCTACTCCTTTGAGGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000379437    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020286.3-1300s21c1
Sequence:GTACCGGTCTATGGCATCAGGAACATAACTCGAGTTATGTTCCTGATGCCATAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000379552    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020286.3-1333s21c1
Sequence:GTACCGGATGTTGAGGTCAACCAATTTCCTCGAGGAAATTGGTTGACCTCAACATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_139022
TSPAN32 MISSION shRNA Bacterial Glycerol Stock
tetraspanin 32
Human
3 Products Total
TRC Number Price Set Price (3)? Select
TRCN0000373913    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139022.2-822s21c1
Sequence:CCGGTTGGACCGCAAGGGCAAATACCTCGAGGTATTTGCCCTTGCGGTCCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000373828    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139022.2-179s21c1
Sequence:CCGGGCTGGTCACCTGCTTCTTTATCTCGAGATAAAGAAGCAGGTGACCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000373912    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139022.2-228s21c1
Sequence:CCGGATGGTGACTCTTACCTACTTCCTCGAGGAAGTAGGTAAGAGTCACCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_139022
TSPAN32 MISSION shRNA shRNA Plasmid DNA
tetraspanin 32
Human
3 Products Total
TRC Number Vector Price Set Price (3)? Select
TRCN0000373913    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139022.2-822s21c1
Sequence:CCGGTTGGACCGCAAGGGCAAATACCTCGAGGTATTTGCCCTTGCGGTCCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000373828    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139022.2-179s21c1
Sequence:CCGGGCTGGTCACCTGCTTCTTTATCTCGAGATAAAGAAGCAGGTGACCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000373912    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139022.2-228s21c1
Sequence:CCGGATGGTGACTCTTACCTACTTCCTCGAGGAAGTAGGTAAGAGTCACCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_139022
TSPAN32 MISSION shRNA Lentiviral Transduction Particles
tetraspanin 32
Human
3 Products Total
TRC Number Volume Titer Vector Price Set Price (3)? Select
TRCN0000373913    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139022.2-822s21c1
Sequence:CCGGTTGGACCGCAAGGGCAAATACCTCGAGGTATTTGCCCTTGCGGTCCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000373828    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139022.2-179s21c1
Sequence:CCGGGCTGGTCACCTGCTTCTTTATCTCGAGATAAAGAAGCAGGTGACCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000373912    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_139022.2-228s21c1
Sequence:CCGGATGGTGACTCTTACCTACTTCCTCGAGGAAGTAGGTAAGAGTCACCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks