EMAIL THIS PAGE TO A FRIEND

TSPAN33

tetraspanin 33

Synonyms: PEN
UniProtKB ID: Q86UF1
Gene ID:
Mouse(232670) tetraspanin 33
Rat(500065) tetraspanin 33
cow(539284) tetraspanin 33
sheep(101113842) tetraspanin 33
naked mole-rat(101710984) tetraspanin 33
Zebrafish(436890) tetraspanin 33
domestic cat(101083502) tetraspanin 33
dog(475198) tetraspanin 33
52 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA020357 Anti-TSPAN33 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry pricing
SAB2103586 Anti-TSPAN33 antibody produced in rabbit affinity isolated antibody bovine, mouse, zebrafish, human, horse, rabbit, guinea pig, rat
western blot pricing
SAB2107142 Anti-TSPAN33 antibody produced in rabbit affinity isolated antibody horse, rabbit, human, rat
ELISA, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_178562 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_178562 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_178562 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_146173 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_146173 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_146173 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_178562 Rosetta Predictions human pricing
NM_001109227 Rosetta Predictions rat pricing
NM_146173 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_178562 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00214957 predicted 876
2 SASI_Hs01_00214958 predicted 856
3 SASI_Hs01_00214959 predicted 636
4 SASI_Hs01_00214960 predicted 919
5 SASI_Hs01_00214961 predicted 936
6 SASI_Hs01_00214962 predicted 893
7 SASI_Hs01_00214963 predicted 843
8 SASI_Hs01_00214964 predicted 582
9 SASI_Hs02_00369813 predicted 977
10 SASI_Hs01_00214965 predicted 1148
11 SASI_Hs01_00214966 predicted 939
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001109227 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00246334 predicted 855
2 SASI_Rn02_00246335 predicted 1280
3 SASI_Rn02_00246336 predicted 840
4 SASI_Rn02_00246337 predicted 326
5 SASI_Rn02_00246338 predicted 1114
6 SASI_Rn02_00246339 predicted 828
7 SASI_Rn02_00246340 predicted 1151
8 SASI_Rn02_00246341 predicted 799
9 SASI_Rn02_00246342 predicted 391
10 SASI_Rn02_00246343 predicted 613
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_146173 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00198044 predicted 1325
2 SASI_Mm01_00198045 predicted 312
3 SASI_Mm01_00198046 predicted 801
4 SASI_Mm01_00198047 predicted 1231
5 SASI_Mm01_00198048 predicted 820
6 SASI_Mm01_00198049 predicted 1136
7 SASI_Mm01_00198050 predicted 568
8 SASI_Mm01_00198051 predicted 854
9 SASI_Mm01_00198052 predicted 1257
10 SASI_Mm02_00341873 predicted 864
11 SASI_Mm01_00198053 predicted 383
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_178562
VALIDATED
TSPAN33 MISSION shRNA Bacterial Glycerol Stock
tetraspanin 33
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000156331    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_178562.2-635s1c1
Sequence:CCGGCACTACCGAGATGACTTGGATCTCGAGATCCAAGTCATCTCGGTAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000152435    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178562.2-301s1c1
Sequence:CCGGCCTGCTCTTCTTCTTCAACATCTCGAGATGTTGAAGAAGAAGAGCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000152777    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178562.2-304s1c1
Sequence:CCGGGCTCTTCTTCTTCAACATGCTCTCGAGAGCATGTTGAAGAAGAAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000152822    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178562.2-1448s1c1
Sequence:CCGGGCGGACATACTTAGATCCTAACTCGAGTTAGGATCTAAGTATGTCCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000158106    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178562.2-328s1c1
Sequence:CCGGCTGGGTGATTTCCATGGTGATCTCGAGATCACCATGGAAATCACCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_178562
VALIDATED
TSPAN33 MISSION shRNA shRNA Plasmid DNA
tetraspanin 33
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000156331    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_178562.2-635s1c1
Sequence:CCGGCACTACCGAGATGACTTGGATCTCGAGATCCAAGTCATCTCGGTAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000152435    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178562.2-301s1c1
Sequence:CCGGCCTGCTCTTCTTCTTCAACATCTCGAGATGTTGAAGAAGAAGAGCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000152777    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178562.2-304s1c1
Sequence:CCGGGCTCTTCTTCTTCAACATGCTCTCGAGAGCATGTTGAAGAAGAAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000152822    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178562.2-1448s1c1
Sequence:CCGGGCGGACATACTTAGATCCTAACTCGAGTTAGGATCTAAGTATGTCCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000158106    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178562.2-328s1c1
Sequence:CCGGCTGGGTGATTTCCATGGTGATCTCGAGATCACCATGGAAATCACCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_178562
VALIDATED
TSPAN33 MISSION shRNA Lentiviral Transduction Particles
tetraspanin 33
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000156331    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_178562.2-635s1c1
Sequence:CCGGCACTACCGAGATGACTTGGATCTCGAGATCCAAGTCATCTCGGTAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000152435    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178562.2-301s1c1
Sequence:CCGGCCTGCTCTTCTTCTTCAACATCTCGAGATGTTGAAGAAGAAGAGCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000152777    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178562.2-304s1c1
Sequence:CCGGGCTCTTCTTCTTCAACATGCTCTCGAGAGCATGTTGAAGAAGAAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000152822    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178562.2-1448s1c1
Sequence:CCGGGCGGACATACTTAGATCCTAACTCGAGTTAGGATCTAAGTATGTCCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000158106    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178562.2-328s1c1
Sequence:CCGGCTGGGTGATTTCCATGGTGATCTCGAGATCACCATGGAAATCACCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_146173
TSPAN33 MISSION shRNA Bacterial Glycerol Stock
tetraspanin 33
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000094709    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_146173.1-1244s1c1
Sequence:CCGGCGAGGTTTATTTCATGCTGTTCTCGAGAACAGCATGAAATAAACCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000094711    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146173.1-679s1c1
Sequence:CCGGCTGGTCTCAGAATATGTACTTCTCGAGAAGTACATATTCTGAGACCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000094712    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146173.1-682s1c1
Sequence:CCGGGTCTCAGAATATGTACTTCAACTCGAGTTGAAGTACATATTCTGAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000094713    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146173.1-576s1c1
Sequence:CCGGTCAACAATGCTATCGTGCATTCTCGAGAATGCACGATAGCATTGTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000094710    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146173.1-563s1c1
Sequence:CCGGGTGAGCGAGATCATCAACAATCTCGAGATTGTTGATGATCTCGCTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_146173
TSPAN33 MISSION shRNA shRNA Plasmid DNA
tetraspanin 33
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000094709    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_146173.1-1244s1c1
Sequence:CCGGCGAGGTTTATTTCATGCTGTTCTCGAGAACAGCATGAAATAAACCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000094711    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146173.1-679s1c1
Sequence:CCGGCTGGTCTCAGAATATGTACTTCTCGAGAAGTACATATTCTGAGACCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000094712    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146173.1-682s1c1
Sequence:CCGGGTCTCAGAATATGTACTTCAACTCGAGTTGAAGTACATATTCTGAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000094713    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146173.1-576s1c1
Sequence:CCGGTCAACAATGCTATCGTGCATTCTCGAGAATGCACGATAGCATTGTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000094710    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146173.1-563s1c1
Sequence:CCGGGTGAGCGAGATCATCAACAATCTCGAGATTGTTGATGATCTCGCTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_146173
TSPAN33 MISSION shRNA Lentiviral Transduction Particles
tetraspanin 33
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000094709    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_146173.1-1244s1c1
Sequence:CCGGCGAGGTTTATTTCATGCTGTTCTCGAGAACAGCATGAAATAAACCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000094711    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146173.1-679s1c1
Sequence:CCGGCTGGTCTCAGAATATGTACTTCTCGAGAAGTACATATTCTGAGACCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000094712    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146173.1-682s1c1
Sequence:CCGGGTCTCAGAATATGTACTTCAACTCGAGTTGAAGTACATATTCTGAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000094713    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146173.1-576s1c1
Sequence:CCGGTCAACAATGCTATCGTGCATTCTCGAGAATGCACGATAGCATTGTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000094710    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146173.1-563s1c1
Sequence:CCGGGTGAGCGAGATCATCAACAATCTCGAGATTGTTGATGATCTCGCTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks