EMAIL THIS PAGE TO A FRIEND

TSPAN3

tetraspanin 3

Synonyms: TM4-A TM4SF8 TSPAN-3
UniProtKB ID: O60637, A6NEH4, B3KQQ2, B4DP19, Q9BW22, Q9NVX9
Gene ID:
Human(10099) Summary: The protein encoded by this gene is a member of the transmembrane 4 superfamily, also known as the tetraspanin family. Most of these members are cell-surface proteins that are characterized by the presence of four hydrophobic domains. The proteins mediate signal transduction events that play a role in the regulation of cell development, activation, growth and motility. The use of alternate polyadenylation sites has been found for this gene. Multiple alternative transcripts encoding different isoforms have been described. [provided by RefSeq, Dec 2009]
Mouse(56434) tetraspanin 3
Rat(300733) tetraspanin 3
chicken(415348) tetraspanin 3
dog(487663) tetraspanin 3
domestic cat(101100473) tetraspanin 3
cow(616881) tetraspanin 3
sheep(101103760) tetraspanin 3
137 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_019793 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_019793 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_019793 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_005724 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005724 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005724 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005724 Rosetta Predictions human pricing
NM_198902 Rosetta Predictions human pricing
NM_001005547 Rosetta Predictions rat pricing
NM_019793 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005724 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00084659 predicted 1001
2 SASI_Hs01_00084660 predicted 869
3 SASI_Hs01_00084661 predicted 1075
4 SASI_Hs01_00084662 predicted 1348
5 SASI_Hs01_00084663 predicted 947
6 SASI_Hs01_00084665 predicted 1192
7 SASI_Hs01_00084666 predicted 1234
8 SASI_Hs01_00084667 predicted 1129
9 SASI_Hs01_00084668 predicted 828
10 SASI_Hs02_00340146 predicted 936
11 SASI_Hs01_00084664 predicted 1211
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198902 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00239243 predicted 928
2 SASI_Hs01_00239244 predicted 803
3 SASI_Hs01_00239245 predicted 999
4 SASI_Hs01_00239246 predicted 1272
5 SASI_Hs01_00239247 predicted 872
6 SASI_Hs01_00239249 predicted 1120
7 SASI_Hs01_00239250 predicted 1164
8 SASI_Hs01_00239251 predicted 1055
9 SASI_Hs01_00239252 predicted 753
10 SASI_Hs02_00372400 predicted 854
11 SASI_Hs01_00239248 predicted 1140
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001005547 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00042202 predicted 213
2 SASI_Rn02_00198406 predicted 1029
3 SASI_Rn01_00042203 predicted 439
4 SASI_Rn01_00042204 predicted 706
5 SASI_Rn01_00042205 predicted 869
6 SASI_Rn02_00198407 predicted 450
7 SASI_Rn01_00042206 predicted 1138
8 SASI_Rn01_00042207 predicted 1007
9 SASI_Rn01_00042208 predicted 726
10 SASI_Rn01_00042209 predicted 1064
11 SASI_Rn01_00042210 predicted 489
12 SASI_Rn01_00042211 predicted 764
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019793 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00116931 predicted 279
2 SASI_Mm01_00116932 predicted 799
3 SASI_Mm01_00116934 predicted 961
4 SASI_Mm01_00116935 predicted 1172
5 SASI_Mm02_00325013 predicted 1148
6 SASI_Mm01_00116937 predicted 535
7 SASI_Mm01_00116938 predicted 202
8 SASI_Mm01_00116939 predicted 1027
9 SASI_Mm02_00325014 predicted 526
10 SASI_Mm02_00325015 predicted 845
11 SASI_Mm01_00116930 predicted 1116
12 SASI_Mm01_00116933 predicted 1173
13 SASI_Mm01_00116936 predicted 1154
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_019793
VALIDATED
TSPAN3 MISSION shRNA Bacterial Glycerol Stock
tetraspanin 3
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000094611    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019793.2-312s1c1
Sequence:CCGGCCACTTCTTCGAGGATGTGTACTCGAGTACACATCCTCGAAGAAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000094612    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019793.2-784s1c1
Sequence:CCGGCTTGTTGTGAAGAAGCTACAACTCGAGTTGTAGCTTCTTCACAACAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000094613    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019793.2-637s1c1
Sequence:CCGGCATAACTATTCAGACTGGGAACTCGAGTTCCCAGTCTGAATAGTTATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000094609    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019793.2-1152s1c1
Sequence:CCGGGCCCTTAATTTCAGAACCATTCTCGAGAATGGTTCTGAAATTAAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000094610    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019793.2-535s1c1
Sequence:CCGGCGCAGCATTCAGAAAGTGTATCTCGAGATACACTTTCTGAATGCTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000316433    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019793.2-1152s21c1
Sequence:CCGGGCCCTTAATTTCAGAACCATTCTCGAGAATGGTTCTGAAATTAAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000316354    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019793.2-535s21c1
Sequence:CCGGCGCAGCATTCAGAAAGTGTATCTCGAGATACACTTTCTGAATGCTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000316432    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019793.2-312s21c1
Sequence:CCGGCCACTTCTTCGAGGATGTGTACTCGAGTACACATCCTCGAAGAAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000349181    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019793.2-784s21c1
Sequence:CCGGCTTGTTGTGAAGAAGCTACAACTCGAGTTGTAGCTTCTTCACAACAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_019793
VALIDATED
TSPAN3 MISSION shRNA shRNA Plasmid DNA
tetraspanin 3
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000094611    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019793.2-312s1c1
Sequence:CCGGCCACTTCTTCGAGGATGTGTACTCGAGTACACATCCTCGAAGAAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000094612    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019793.2-784s1c1
Sequence:CCGGCTTGTTGTGAAGAAGCTACAACTCGAGTTGTAGCTTCTTCACAACAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000094613    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019793.2-637s1c1
Sequence:CCGGCATAACTATTCAGACTGGGAACTCGAGTTCCCAGTCTGAATAGTTATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000094609    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019793.2-1152s1c1
Sequence:CCGGGCCCTTAATTTCAGAACCATTCTCGAGAATGGTTCTGAAATTAAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000094610    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019793.2-535s1c1
Sequence:CCGGCGCAGCATTCAGAAAGTGTATCTCGAGATACACTTTCTGAATGCTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000316433    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019793.2-1152s21c1
Sequence:CCGGGCCCTTAATTTCAGAACCATTCTCGAGAATGGTTCTGAAATTAAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000316354    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019793.2-535s21c1
Sequence:CCGGCGCAGCATTCAGAAAGTGTATCTCGAGATACACTTTCTGAATGCTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000316432    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019793.2-312s21c1
Sequence:CCGGCCACTTCTTCGAGGATGTGTACTCGAGTACACATCCTCGAAGAAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000349181    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019793.2-784s21c1
Sequence:CCGGCTTGTTGTGAAGAAGCTACAACTCGAGTTGTAGCTTCTTCACAACAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_019793
VALIDATED
TSPAN3 MISSION shRNA Lentiviral Transduction Particles
tetraspanin 3
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000094611    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019793.2-312s1c1
Sequence:CCGGCCACTTCTTCGAGGATGTGTACTCGAGTACACATCCTCGAAGAAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000094612    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019793.2-784s1c1
Sequence:CCGGCTTGTTGTGAAGAAGCTACAACTCGAGTTGTAGCTTCTTCACAACAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000094613    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019793.2-637s1c1
Sequence:CCGGCATAACTATTCAGACTGGGAACTCGAGTTCCCAGTCTGAATAGTTATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000094609    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019793.2-1152s1c1
Sequence:CCGGGCCCTTAATTTCAGAACCATTCTCGAGAATGGTTCTGAAATTAAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000094610    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019793.2-535s1c1
Sequence:CCGGCGCAGCATTCAGAAAGTGTATCTCGAGATACACTTTCTGAATGCTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000316433    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019793.2-1152s21c1
Sequence:CCGGGCCCTTAATTTCAGAACCATTCTCGAGAATGGTTCTGAAATTAAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000316354    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019793.2-535s21c1
Sequence:CCGGCGCAGCATTCAGAAAGTGTATCTCGAGATACACTTTCTGAATGCTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000316432    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019793.2-312s21c1
Sequence:CCGGCCACTTCTTCGAGGATGTGTACTCGAGTACACATCCTCGAAGAAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000349181    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019793.2-784s21c1
Sequence:CCGGCTTGTTGTGAAGAAGCTACAACTCGAGTTGTAGCTTCTTCACAACAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005724
VALIDATED
TSPAN3 MISSION shRNA Bacterial Glycerol Stock
tetraspanin 3
Human
14 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000118202    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005724.4-1211s1c1
Sequence:CCGGCGTTCTAATTTCAGAACCAATCTCGAGATTGGTTCTGAAATTAGAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000118203    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005724.4-863s1c1
Sequence:CCGGGCACTGGCATTTGCAGCTATTCTCGAGAATAGCTGCAAATGCCAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000118204    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005724.4-568s1c1
Sequence:CCGGCAGCATTCAGAAAGTGTATAACTCGAGTTATACACTTTCTGAATGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000118206    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005724.4-924s1c1
Sequence:CCGGGAAGGAGTAGAGATCCTGCTTCTCGAGAAGCAGGATCTCTACTCCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000118205    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005724.4-812s1c1
Sequence:CCGGGCTCTAGTAGTGAAGAAGCTACTCGAGTAGCTTCTTCACTACTAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000382001    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005724.4-962s21c1
Sequence:GTACCGGGGCGGAACCTATGCATAGTTGCTCGAGCAACTATGCATAGGTTCCGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000300888    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005724.4-568s21c1
Sequence:CCGGCAGCATTCAGAAAGTGTATAACTCGAGTTATACACTTTCTGAATGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000300950    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_005724.4-924s21c1
Sequence:CCGGGAAGGAGTAGAGATCCTGCTTCTCGAGAAGCAGGATCTCTACTCCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000304164    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_005724.4-311s21c1
Sequence:CCGGGCCTATGTCTTCATCACTTATCTCGAGATAAGTGATGAAGACATAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000304227    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005724.4-372s21c1
Sequence:CCGGTCCCTGCTGTAGTGATCATAGCTCGAGCTATGATCACTACAGCAGGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000380724    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005724.4-746s21c1
Sequence:GTACCGGGAGACTGCCAGCAATTGTAATCTCGAGATTACAATTGCTGGCAGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000331692    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_005724.4-1211s21c1
Sequence:CCGGCGTTCTAATTTCAGAACCAATCTCGAGATTGGTTCTGAAATTAGAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000381150    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005724.4-864s21c1
Sequence:GTACCGGCACTGGCATTTGCAGCTATTCCTCGAGGAATAGCTGCAAATGCCAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000381861    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005724.4-458s21c1
Sequence:GTACCGGTGTGGACTTGCCACGTTTGTCCTCGAGGACAAACGTGGCAAGTCCACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005724
VALIDATED
TSPAN3 MISSION shRNA shRNA Plasmid DNA
tetraspanin 3
Human
14 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000118202    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005724.4-1211s1c1
Sequence:CCGGCGTTCTAATTTCAGAACCAATCTCGAGATTGGTTCTGAAATTAGAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000118203    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005724.4-863s1c1
Sequence:CCGGGCACTGGCATTTGCAGCTATTCTCGAGAATAGCTGCAAATGCCAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000118204    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005724.4-568s1c1
Sequence:CCGGCAGCATTCAGAAAGTGTATAACTCGAGTTATACACTTTCTGAATGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000118206    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005724.4-924s1c1
Sequence:CCGGGAAGGAGTAGAGATCCTGCTTCTCGAGAAGCAGGATCTCTACTCCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000118205    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005724.4-812s1c1
Sequence:CCGGGCTCTAGTAGTGAAGAAGCTACTCGAGTAGCTTCTTCACTACTAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000382001    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005724.4-962s21c1
Sequence:GTACCGGGGCGGAACCTATGCATAGTTGCTCGAGCAACTATGCATAGGTTCCGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000300888    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005724.4-568s21c1
Sequence:CCGGCAGCATTCAGAAAGTGTATAACTCGAGTTATACACTTTCTGAATGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000300950    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_005724.4-924s21c1
Sequence:CCGGGAAGGAGTAGAGATCCTGCTTCTCGAGAAGCAGGATCTCTACTCCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000304164    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_005724.4-311s21c1
Sequence:CCGGGCCTATGTCTTCATCACTTATCTCGAGATAAGTGATGAAGACATAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000304227    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005724.4-372s21c1
Sequence:CCGGTCCCTGCTGTAGTGATCATAGCTCGAGCTATGATCACTACAGCAGGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000380724    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005724.4-746s21c1
Sequence:GTACCGGGAGACTGCCAGCAATTGTAATCTCGAGATTACAATTGCTGGCAGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000331692    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_005724.4-1211s21c1
Sequence:CCGGCGTTCTAATTTCAGAACCAATCTCGAGATTGGTTCTGAAATTAGAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000381150    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005724.4-864s21c1
Sequence:GTACCGGCACTGGCATTTGCAGCTATTCCTCGAGGAATAGCTGCAAATGCCAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000381861    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005724.4-458s21c1
Sequence:GTACCGGTGTGGACTTGCCACGTTTGTCCTCGAGGACAAACGTGGCAAGTCCACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005724
VALIDATED
TSPAN3 MISSION shRNA Lentiviral Transduction Particles
tetraspanin 3
Human
14 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000118202    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005724.4-1211s1c1
Sequence:CCGGCGTTCTAATTTCAGAACCAATCTCGAGATTGGTTCTGAAATTAGAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000118203    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005724.4-863s1c1
Sequence:CCGGGCACTGGCATTTGCAGCTATTCTCGAGAATAGCTGCAAATGCCAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000118204    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005724.4-568s1c1
Sequence:CCGGCAGCATTCAGAAAGTGTATAACTCGAGTTATACACTTTCTGAATGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000118206    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005724.4-924s1c1
Sequence:CCGGGAAGGAGTAGAGATCCTGCTTCTCGAGAAGCAGGATCTCTACTCCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000118205    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005724.4-812s1c1
Sequence:CCGGGCTCTAGTAGTGAAGAAGCTACTCGAGTAGCTTCTTCACTACTAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000382001    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005724.4-962s21c1
Sequence:GTACCGGGGCGGAACCTATGCATAGTTGCTCGAGCAACTATGCATAGGTTCCGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000300888    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005724.4-568s21c1
Sequence:CCGGCAGCATTCAGAAAGTGTATAACTCGAGTTATACACTTTCTGAATGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000300950    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_005724.4-924s21c1
Sequence:CCGGGAAGGAGTAGAGATCCTGCTTCTCGAGAAGCAGGATCTCTACTCCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000304164    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_005724.4-311s21c1
Sequence:CCGGGCCTATGTCTTCATCACTTATCTCGAGATAAGTGATGAAGACATAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000304227    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005724.4-372s21c1
Sequence:CCGGTCCCTGCTGTAGTGATCATAGCTCGAGCTATGATCACTACAGCAGGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000380724    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005724.4-746s21c1
Sequence:GTACCGGGAGACTGCCAGCAATTGTAATCTCGAGATTACAATTGCTGGCAGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000331692    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_005724.4-1211s21c1
Sequence:CCGGCGTTCTAATTTCAGAACCAATCTCGAGATTGGTTCTGAAATTAGAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000381150    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005724.4-864s21c1
Sequence:GTACCGGCACTGGCATTTGCAGCTATTCCTCGAGGAATAGCTGCAAATGCCAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000381861    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005724.4-458s21c1
Sequence:GTACCGGTGTGGACTTGCCACGTTTGTCCTCGAGGACAAACGTGGCAAGTCCACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks