EMAIL THIS PAGE TO A FRIEND

TSPAN4

tetraspanin 4

Synonyms: NAG-2 NAG2 TETRASPAN TM4SF7 TSPAN-4
UniProtKB ID: O14817, Q6IAP6
Gene ID:
Human(7106) Summary: The protein encoded by this gene is a member of the transmembrane 4 superfamily, also known as the tetraspanin family. Most of these members are cell-surface proteins that are characterized by the presence of four hydrophobic domains. The proteins mediate signal transduction events that play a role in the regulation of cell development, activation, growth and motility. This encoded protein is a cell surface glycoprotein and is similar in sequence to its family member CD53 antigen. It is known to complex with integrins and other transmembrane 4 superfamily proteins. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2008]
Mouse(64540) tetraspanin 4
Rat(293627) tetraspanin 4
Zebrafish(556934) tetraspanin 4
domestic cat(101098088) tetraspanin 4
chicken(423104) tetraspanin 4
dog(611422) tetraspanin 4
cow(505288) tetraspanin 4
sheep(101122149) tetraspanin 4
106 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_053082 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_053082 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_053082 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001025239 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001025239 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001025239 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EMU023281 MISSION® esiRNA esiRNA targeting mouse Tspan4 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001025234 Rosetta Predictions human pricing
NM_001025235 Rosetta Predictions human pricing
NM_001025236 Rosetta Predictions human pricing
NM_001025237 Rosetta Predictions human pricing
NM_001025238 Rosetta Predictions human pricing
NM_001025239 Rosetta Predictions human pricing
NM_003271 Rosetta Predictions human pricing
NM_001013070 Rosetta Predictions rat pricing
NM_053082 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001025234 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00018374 predicted 902
2 SASI_Hs01_00018375 predicted 798
3 SASI_Hs01_00018376 predicted 544
4 SASI_Hs01_00018377 predicted 532
5 SASI_Hs01_00018378 predicted 518
6 SASI_Hs01_00018379 predicted 506
7 SASI_Hs01_00018380 predicted 885
8 SASI_Hs01_00018381 predicted 609
9 SASI_Hs01_00018382 predicted 894
10 SASI_Hs01_00018383 predicted 552
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001025235 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00042442 predicted 902
2 SASI_Hs01_00042443 predicted 790
3 SASI_Hs01_00042444 predicted 536
4 SASI_Hs01_00042445 predicted 535
5 SASI_Hs01_00042446 predicted 521
6 SASI_Hs01_00042447 predicted 513
7 SASI_Hs01_00042448 predicted 885
8 SASI_Hs01_00042449 predicted 604
9 SASI_Hs01_00042450 predicted 891
10 SASI_Hs01_00042451 predicted 549
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001025236 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00215247 predicted 901
2 SASI_Hs01_00215248 predicted 804
3 SASI_Hs01_00215249 predicted 544
4 SASI_Hs01_00215250 predicted 538
5 SASI_Hs01_00215251 predicted 523
6 SASI_Hs01_00215252 predicted 514
7 SASI_Hs01_00215253 predicted 892
8 SASI_Hs01_00215254 predicted 608
9 SASI_Hs01_00215255 predicted 897
10 SASI_Hs01_00215256 predicted 561
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001025237 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00234051 predicted 935
2 SASI_Hs01_00234052 predicted 831
3 SASI_Hs01_00234053 predicted 576
4 SASI_Hs01_00234054 predicted 571
5 SASI_Hs01_00234055 predicted 554
6 SASI_Hs01_00234056 predicted 548
7 SASI_Hs01_00234057 predicted 921
8 SASI_Hs01_00234058 predicted 644
9 SASI_Hs01_00234059 predicted 929
10 SASI_Hs01_00234060 predicted 587
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001025238 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00242001 predicted 780
2 SASI_Hs01_00242002 predicted 684
3 SASI_Hs01_00242003 predicted 424
4 SASI_Hs01_00242004 predicted 423
5 SASI_Hs01_00242005 predicted 403
6 SASI_Hs01_00242006 predicted 393
7 SASI_Hs01_00242007 predicted 770
8 SASI_Hs01_00242008 predicted 489
9 SASI_Hs01_00242009 predicted 778
10 SASI_Hs01_00242010 predicted 444
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001025239 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00011588 predicted 805
2 SASI_Hs01_00011589 predicted 701
3 SASI_Hs01_00011590 predicted 442
4 SASI_Hs01_00011591 predicted 437
5 SASI_Hs01_00011592 predicted 425
6 SASI_Hs01_00011593 predicted 416
7 SASI_Hs01_00011594 predicted 789
8 SASI_Hs01_00011595 predicted 510
9 SASI_Hs01_00011596 predicted 802
10 SASI_Hs01_00011597 predicted 461
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003271 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00172786 predicted 882
2 SASI_Hs01_00172787 predicted 782
3 SASI_Hs01_00172788 predicted 528
4 SASI_Hs01_00172789 predicted 522
5 SASI_Hs01_00172790 predicted 502
6 SASI_Hs01_00172791 predicted 497
7 SASI_Hs01_00172792 predicted 868
8 SASI_Hs01_00172793 predicted 597
9 SASI_Hs01_00172794 predicted 877
10 SASI_Hs01_00172795 predicted 536
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001013070 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00031536 predicted 419
2 SASI_Rn02_00200702 predicted 653
3 SASI_Rn01_00031537 predicted 701
4 SASI_Rn01_00031538 predicted 676
5 SASI_Rn01_00031539 predicted 584
6 SASI_Rn01_00031540 predicted 828
7 SASI_Rn01_00031541 predicted 579
8 SASI_Rn01_00031542 predicted 723
9 SASI_Rn01_00031543 predicted 734
10 SASI_Rn01_00031544 predicted 558
11 SASI_Rn01_00031545 predicted 1061
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053082 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00144846 predicted 431
2 SASI_Mm01_00144847 predicted 593
3 SASI_Mm01_00144848 predicted 596
4 SASI_Mm01_00144849 predicted 702
5 SASI_Mm01_00144850 predicted 683
6 SASI_Mm01_00144851 predicted 838
7 SASI_Mm01_00144852 predicted 655
8 SASI_Mm01_00144853 predicted 587
9 SASI_Mm01_00144854 predicted 726
10 SASI_Mm01_00144855 predicted 741
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_053082
VALIDATED
TSPAN4 MISSION shRNA Bacterial Glycerol Stock
tetraspanin 4
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000094944    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_053082.2-1210s1c1
Sequence:CCGGCCCAGGGAACTTTGACACTTTCTCGAGAAAGTGTCAAAGTTCCCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000094946    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_053082.2-805s1c1
Sequence:CCGGGTGGGTTACATGAACCTGGTACTCGAGTACCAGGTTCATGTAACCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000094948    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_053082.2-305s1c1
Sequence:CCGGGTACCTCATGTTCGCCTTCAACTCGAGTTGAAGGCGAACATGAGGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000094947    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_053082.2-596s1c1
Sequence:CCGGCAGTGACAAGATTGACAGTTACTCGAGTAACTGTCAATCTTGTCACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000094945    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_053082.2-387s1c1
Sequence:CCGGCAGGGAAACTTTGCCACCTTACTCGAGTAAGGTGGCAAAGTTTCCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000326840    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053082.2-596s21c1
Sequence:CCGGCAGTGACAAGATTGACAGTTACTCGAGTAACTGTCAATCTTGTCACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000326839    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_053082.2-1210s21c1
Sequence:CCGGCCCAGGGAACTTTGACACTTTCTCGAGAAAGTGTCAAAGTTCCCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000326838    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053082.2-805s21c1
Sequence:CCGGGTGGGTTACATGAACCTGGTACTCGAGTACCAGGTTCATGTAACCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000326830    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053082.2-305s21c1
Sequence:CCGGGTACCTCATGTTCGCCTTCAACTCGAGTTGAAGGCGAACATGAGGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_053082
VALIDATED
TSPAN4 MISSION shRNA shRNA Plasmid DNA
tetraspanin 4
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000094944    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_053082.2-1210s1c1
Sequence:CCGGCCCAGGGAACTTTGACACTTTCTCGAGAAAGTGTCAAAGTTCCCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000094946    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_053082.2-805s1c1
Sequence:CCGGGTGGGTTACATGAACCTGGTACTCGAGTACCAGGTTCATGTAACCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000094948    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_053082.2-305s1c1
Sequence:CCGGGTACCTCATGTTCGCCTTCAACTCGAGTTGAAGGCGAACATGAGGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000094947    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_053082.2-596s1c1
Sequence:CCGGCAGTGACAAGATTGACAGTTACTCGAGTAACTGTCAATCTTGTCACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000094945    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_053082.2-387s1c1
Sequence:CCGGCAGGGAAACTTTGCCACCTTACTCGAGTAAGGTGGCAAAGTTTCCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000326840    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053082.2-596s21c1
Sequence:CCGGCAGTGACAAGATTGACAGTTACTCGAGTAACTGTCAATCTTGTCACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000326839    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_053082.2-1210s21c1
Sequence:CCGGCCCAGGGAACTTTGACACTTTCTCGAGAAAGTGTCAAAGTTCCCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000326838    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053082.2-805s21c1
Sequence:CCGGGTGGGTTACATGAACCTGGTACTCGAGTACCAGGTTCATGTAACCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000326830    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053082.2-305s21c1
Sequence:CCGGGTACCTCATGTTCGCCTTCAACTCGAGTTGAAGGCGAACATGAGGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_053082
VALIDATED
TSPAN4 MISSION shRNA Lentiviral Transduction Particles
tetraspanin 4
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000094944    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_053082.2-1210s1c1
Sequence:CCGGCCCAGGGAACTTTGACACTTTCTCGAGAAAGTGTCAAAGTTCCCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000094946    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_053082.2-805s1c1
Sequence:CCGGGTGGGTTACATGAACCTGGTACTCGAGTACCAGGTTCATGTAACCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000094948    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_053082.2-305s1c1
Sequence:CCGGGTACCTCATGTTCGCCTTCAACTCGAGTTGAAGGCGAACATGAGGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000094947    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_053082.2-596s1c1
Sequence:CCGGCAGTGACAAGATTGACAGTTACTCGAGTAACTGTCAATCTTGTCACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000094945    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_053082.2-387s1c1
Sequence:CCGGCAGGGAAACTTTGCCACCTTACTCGAGTAAGGTGGCAAAGTTTCCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000326840    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053082.2-596s21c1
Sequence:CCGGCAGTGACAAGATTGACAGTTACTCGAGTAACTGTCAATCTTGTCACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000326839    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_053082.2-1210s21c1
Sequence:CCGGCCCAGGGAACTTTGACACTTTCTCGAGAAAGTGTCAAAGTTCCCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000326838    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053082.2-805s21c1
Sequence:CCGGGTGGGTTACATGAACCTGGTACTCGAGTACCAGGTTCATGTAACCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000326830    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_053082.2-305s21c1
Sequence:CCGGGTACCTCATGTTCGCCTTCAACTCGAGTTGAAGGCGAACATGAGGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001025239
TSPAN4 MISSION shRNA Bacterial Glycerol Stock
tetraspanin 4
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000119103    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001025239.1-451s1c1
Sequence:CCGGACGGACAAGATTGACAGGTATCTCGAGATACCTGTCAATCTTGTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000119104    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001025239.1-579s1c1
Sequence:CCGGCTCCAACTACACTGACTGGTTCTCGAGAACCAGTCAGTGTAGTTGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000119106    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001025239.1-693s1c1
Sequence:CCGGGCCGTGCTACGAGACGGTGAACTCGAGTTCACCGTCTCGTAGCACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000119102    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001025239.1-1119s1c1
Sequence:CCGGCGTATTCTCCAAAGCAGTGTTCTCGAGAACACTGCTTTGGAGAATACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000119105    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001025239.1-796s1c1
Sequence:CCGGGCCATGACCATGTACTGCCAACTCGAGTTGGCAGTACATGGTCATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000382234    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001025239.1-818s21c1
Sequence:GTACCGGTGGTCAAGGCAGACACCTACTCTCGAGAGTAGGTGTCTGCCTTGACCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000380018    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001025239.1-806s21c1
Sequence:GTACCGGTGTACTGCCAAGTGGTCAAGGCTCGAGCCTTGACCACTTGGCAGTACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000380540    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001025239.1-789s21c1
Sequence:GTACCGGGACCTTCGCCATGACCATGTACTCGAGTACATGGTCATGGCGAAGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000381200    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001025239.1-1120s21c1
Sequence:GTACCGGGTATTCTCCAAAGCAGTGTTCCTCGAGGAACACTGCTTTGGAGAATACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000381870    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001025239.1-543s21c1
Sequence:GTACCGGGAGCATCATCCAGACCGACTTCTCGAGAAGTCGGTCTGGATGATGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000382004    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001025239.1-369s21c1
Sequence:GTACCGGGTGCCTCCTGCTCACTTTCTTCTCGAGAAGAAAGTGAGCAGGAGGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001025239
TSPAN4 MISSION shRNA shRNA Plasmid DNA
tetraspanin 4
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000119103    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001025239.1-451s1c1
Sequence:CCGGACGGACAAGATTGACAGGTATCTCGAGATACCTGTCAATCTTGTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000119104    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001025239.1-579s1c1
Sequence:CCGGCTCCAACTACACTGACTGGTTCTCGAGAACCAGTCAGTGTAGTTGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000119106    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001025239.1-693s1c1
Sequence:CCGGGCCGTGCTACGAGACGGTGAACTCGAGTTCACCGTCTCGTAGCACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000119102    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001025239.1-1119s1c1
Sequence:CCGGCGTATTCTCCAAAGCAGTGTTCTCGAGAACACTGCTTTGGAGAATACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000119105    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001025239.1-796s1c1
Sequence:CCGGGCCATGACCATGTACTGCCAACTCGAGTTGGCAGTACATGGTCATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000382234    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001025239.1-818s21c1
Sequence:GTACCGGTGGTCAAGGCAGACACCTACTCTCGAGAGTAGGTGTCTGCCTTGACCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000380018    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001025239.1-806s21c1
Sequence:GTACCGGTGTACTGCCAAGTGGTCAAGGCTCGAGCCTTGACCACTTGGCAGTACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000380540    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001025239.1-789s21c1
Sequence:GTACCGGGACCTTCGCCATGACCATGTACTCGAGTACATGGTCATGGCGAAGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000381200    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001025239.1-1120s21c1
Sequence:GTACCGGGTATTCTCCAAAGCAGTGTTCCTCGAGGAACACTGCTTTGGAGAATACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000381870    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001025239.1-543s21c1
Sequence:GTACCGGGAGCATCATCCAGACCGACTTCTCGAGAAGTCGGTCTGGATGATGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000382004    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001025239.1-369s21c1
Sequence:GTACCGGGTGCCTCCTGCTCACTTTCTTCTCGAGAAGAAAGTGAGCAGGAGGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001025239
TSPAN4 MISSION shRNA Lentiviral Transduction Particles
tetraspanin 4
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000119103    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001025239.1-451s1c1
Sequence:CCGGACGGACAAGATTGACAGGTATCTCGAGATACCTGTCAATCTTGTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000119104    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001025239.1-579s1c1
Sequence:CCGGCTCCAACTACACTGACTGGTTCTCGAGAACCAGTCAGTGTAGTTGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000119106    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001025239.1-693s1c1
Sequence:CCGGGCCGTGCTACGAGACGGTGAACTCGAGTTCACCGTCTCGTAGCACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000119102    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001025239.1-1119s1c1
Sequence:CCGGCGTATTCTCCAAAGCAGTGTTCTCGAGAACACTGCTTTGGAGAATACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000119105    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001025239.1-796s1c1
Sequence:CCGGGCCATGACCATGTACTGCCAACTCGAGTTGGCAGTACATGGTCATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000382234    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001025239.1-818s21c1
Sequence:GTACCGGTGGTCAAGGCAGACACCTACTCTCGAGAGTAGGTGTCTGCCTTGACCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000380018    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001025239.1-806s21c1
Sequence:GTACCGGTGTACTGCCAAGTGGTCAAGGCTCGAGCCTTGACCACTTGGCAGTACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000380540    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001025239.1-789s21c1
Sequence:GTACCGGGACCTTCGCCATGACCATGTACTCGAGTACATGGTCATGGCGAAGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000381200    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001025239.1-1120s21c1
Sequence:GTACCGGGTATTCTCCAAAGCAGTGTTCCTCGAGGAACACTGCTTTGGAGAATACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000381870    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001025239.1-543s21c1
Sequence:GTACCGGGAGCATCATCCAGACCGACTTCTCGAGAAGTCGGTCTGGATGATGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000382004    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001025239.1-369s21c1
Sequence:GTACCGGGTGCCTCCTGCTCACTTTCTTCTCGAGAAGAAAGTGAGCAGGAGGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks