EMAIL THIS PAGE TO A FRIEND

TSPAN5

tetraspanin 5

Synonyms: NET-4 NET4 TM4SF9 TSPAN-5
UniProtKB ID: P62079, B2RDY2, O60628, O60746, Q6FHE5, Q9JLY1
Gene ID:
Human(10098) Summary: The protein encoded by this gene is a member of the transmembrane 4 superfamily, also known as the tetraspanin family. Most of these members are cell-surface proteins that are characterized by the presence of four hydrophobic domains. The proteins mediate signal transduction events that play a role in the regulation of cell development, activation, growth and motility. [provided by RefSeq, Jul 2008]
Mouse(56224) tetraspanin 5
Rat(362048) tetraspanin 5
cow(538668) tetraspanin 5
sheep(100180629) tetraspanin 5
chicken(422702) tetraspanin 5
dog(478486) tetraspanin 5
domestic cat(101088926) tetraspanin 5
93 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB2108599 Anti-TSPAN5 affinity isolated antibody goat, rabbit, horse, human, canine, guinea pig, bovine, rat
immunohistochemistry, western blot pricing
SAB1303847 ANTI-TSPAN5 (C-TERM) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human, mouse
flow cytometry, western blot pricing
SAB2502124 Anti-TSPAN5 (N-terminal) antibody produced in goat affinity isolated antibody, buffered aqueous solution human, pig, bovine, mouse, rat, canine
ELISA, western blot pricing
AV46640 Anti-TSPAN5 antibody produced in rabbit affinity isolated antibody canine, mouse, rabbit, human, rat, guinea pig, horse, bovine
immunohistochemistry, western blot pricing
HPA067655 Anti-TSPAN5 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_005723 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005723 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005723 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_019571 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_019571 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_019571 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005723 Rosetta Predictions human pricing
NM_001004090 Rosetta Predictions rat pricing
XM_579121 Rosetta Predictions rat pricing
NM_019571 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005723 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00200737 predicted 1089
2 SASI_Hs01_00200738 predicted 979
3 SASI_Hs01_00200739 predicted 701
4 SASI_Hs01_00200740 predicted 374
5 SASI_Hs01_00200741 predicted 819
6 SASI_Hs01_00200742 predicted 531
7 SASI_Hs01_00200743 predicted 1109
8 SASI_Hs01_00200744 predicted 1072
9 SASI_Hs01_00200745 predicted 586
10 SASI_Hs01_00200746 predicted 741
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001004090 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00043298 predicted 752
2 SASI_Rn01_00043299 predicted 280
3 SASI_Rn02_00198139 predicted 751
4 SASI_Rn01_00043300 predicted 402
5 SASI_Rn02_00198140 predicted 744
6 SASI_Rn01_00043301 predicted 349
7 SASI_Rn01_00043303 predicted 720
8 SASI_Rn01_00043305 predicted 761
9 SASI_Rn01_00043306 predicted 635
10 SASI_Rn02_00198141 predicted 1198
11 SASI_Rn01_00043297 predicted 407
12 SASI_Rn01_00043302 predicted 551
13 SASI_Rn01_00043304 predicted 1138
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_579121 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00148965 predicted 208
2 SASI_Rn01_00148966 predicted 402
3 SASI_Rn01_00148967 predicted 457
4 SASI_Rn01_00148968 predicted 518
5 SASI_Rn01_00148969 predicted 274
6 SASI_Rn01_00148970 predicted 465
7 SASI_Rn01_00148971 predicted 474
8 SASI_Rn01_00148972 predicted 461
9 SASI_Rn01_00148973 predicted 409
10 SASI_Rn01_00148974 predicted 318
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019571 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00041923 predicted 414
2 SASI_Mm01_00041924 predicted 1128
3 SASI_Mm01_00041926 predicted 851
4 SASI_Mm01_00041927 predicted 1012
5 SASI_Mm01_00041928 predicted 736
6 SASI_Mm02_00324626 predicted 1102
7 SASI_Mm01_00041929 predicted 466
8 SASI_Mm01_00041930 predicted 1144
9 SASI_Mm01_00041931 predicted 641
10 SASI_Mm01_00041932 predicted 1275
11 SASI_Mm01_00041925 predicted 789
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005723
VALIDATED
TSPAN5 MISSION shRNA Bacterial Glycerol Stock
tetraspanin 5
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000229388    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005723.2-669s21c1
Sequence:CCGGACTGCCGGAGTTCTAGCATTTCTCGAGAAATGCTAGAACTCCGGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000229389    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005723.2-749s21c1
Sequence:CCGGATATCGGGATGACATTGATTTCTCGAGAAATCAATGTCATCCCGATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000229391    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005723.2-1231s21c1
Sequence:CCGGTTCGAGCTGCATGGACCTAATCTCGAGATTAGGTCCATGCAGCTCGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000218149    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005723.2-781s21c1
Sequence:GTACCGGTAGACTTCACCCAGGAATATTCTCGAGAATATTCCTGGGTGAAGTCTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000229390    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005723.2-826s21c1
Sequence:CCGGCTGATGATTGGAACCTAAATACTCGAGTATTTAGGTTCCAATCATCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000119205    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_005723.2-823s1c1
Sequence:CCGGGAGCTGATGATTGGAACCTAACTCGAGTTAGGTTCCAATCATCAGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000119206    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_005723.2-986s1c1
Sequence:CCGGGCAGATTGTAATCTACACGAACTCGAGTTCGTGTAGATTACAATCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000119202    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_005723.2-1222s1c1
Sequence:CCGGGAACTGATCTTCGAGCTGCATCTCGAGATGCAGCTCGAAGATCAGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000119204    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_005723.2-1110s1c1
Sequence:CCGGGCCCAGAATTTGGTTAGCGATCTCGAGATCGCTAACCAAATTCTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000119203    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_005723.2-673s1c1
Sequence:CCGGCCGGAGTTCTAGCATTTGTTTCTCGAGAAACAAATGCTAGAACTCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005723
VALIDATED
TSPAN5 MISSION shRNA shRNA Plasmid DNA
tetraspanin 5
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000229388    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005723.2-669s21c1
Sequence:CCGGACTGCCGGAGTTCTAGCATTTCTCGAGAAATGCTAGAACTCCGGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000229389    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005723.2-749s21c1
Sequence:CCGGATATCGGGATGACATTGATTTCTCGAGAAATCAATGTCATCCCGATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000229391    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005723.2-1231s21c1
Sequence:CCGGTTCGAGCTGCATGGACCTAATCTCGAGATTAGGTCCATGCAGCTCGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000218149    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005723.2-781s21c1
Sequence:GTACCGGTAGACTTCACCCAGGAATATTCTCGAGAATATTCCTGGGTGAAGTCTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000229390    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005723.2-826s21c1
Sequence:CCGGCTGATGATTGGAACCTAAATACTCGAGTATTTAGGTTCCAATCATCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000119205    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_005723.2-823s1c1
Sequence:CCGGGAGCTGATGATTGGAACCTAACTCGAGTTAGGTTCCAATCATCAGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000119206    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_005723.2-986s1c1
Sequence:CCGGGCAGATTGTAATCTACACGAACTCGAGTTCGTGTAGATTACAATCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000119202    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_005723.2-1222s1c1
Sequence:CCGGGAACTGATCTTCGAGCTGCATCTCGAGATGCAGCTCGAAGATCAGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000119204    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_005723.2-1110s1c1
Sequence:CCGGGCCCAGAATTTGGTTAGCGATCTCGAGATCGCTAACCAAATTCTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000119203    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_005723.2-673s1c1
Sequence:CCGGCCGGAGTTCTAGCATTTGTTTCTCGAGAAACAAATGCTAGAACTCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005723
VALIDATED
TSPAN5 MISSION shRNA Lentiviral Transduction Particles
tetraspanin 5
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000229388    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005723.2-669s21c1
Sequence:CCGGACTGCCGGAGTTCTAGCATTTCTCGAGAAATGCTAGAACTCCGGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000229389    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005723.2-749s21c1
Sequence:CCGGATATCGGGATGACATTGATTTCTCGAGAAATCAATGTCATCCCGATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000229391    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005723.2-1231s21c1
Sequence:CCGGTTCGAGCTGCATGGACCTAATCTCGAGATTAGGTCCATGCAGCTCGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000218149    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005723.2-781s21c1
Sequence:GTACCGGTAGACTTCACCCAGGAATATTCTCGAGAATATTCCTGGGTGAAGTCTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000229390    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005723.2-826s21c1
Sequence:CCGGCTGATGATTGGAACCTAAATACTCGAGTATTTAGGTTCCAATCATCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000119205    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_005723.2-823s1c1
Sequence:CCGGGAGCTGATGATTGGAACCTAACTCGAGTTAGGTTCCAATCATCAGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000119206    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_005723.2-986s1c1
Sequence:CCGGGCAGATTGTAATCTACACGAACTCGAGTTCGTGTAGATTACAATCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000119202    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_005723.2-1222s1c1
Sequence:CCGGGAACTGATCTTCGAGCTGCATCTCGAGATGCAGCTCGAAGATCAGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000119204    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_005723.2-1110s1c1
Sequence:CCGGGCCCAGAATTTGGTTAGCGATCTCGAGATCGCTAACCAAATTCTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000119203    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_005723.2-673s1c1
Sequence:CCGGCCGGAGTTCTAGCATTTGTTTCTCGAGAAACAAATGCTAGAACTCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_019571
VALIDATED
TSPAN5 MISSION shRNA Bacterial Glycerol Stock
tetraspanin 5
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000094994    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019571.1-2641s1c1
Sequence:CCGGGCAGATTTAGTTTGTGGGTTTCTCGAGAAACCCACAAACTAAATCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000094995    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019571.1-862s1c1
Sequence:CCGGGCTGATGATTGGAACCTAAATCTCGAGATTTAGGTTCCAATCATCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000094998    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019571.1-417s1c1
Sequence:CCGGAGTCAGTTGTTGCATCAAATACTCGAGTATTTGATGCAACAACTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000094997    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019571.1-863s1c1
Sequence:CCGGCTGATGATTGGAACCTAAATACTCGAGTATTTAGGTTCCAATCATCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000094996    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019571.1-1112s1c1
Sequence:CCGGGCATTGCATTGCTACAGATTTCTCGAGAAATCTGTAGCAATGCAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_019571
VALIDATED
TSPAN5 MISSION shRNA shRNA Plasmid DNA
tetraspanin 5
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000094994    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019571.1-2641s1c1
Sequence:CCGGGCAGATTTAGTTTGTGGGTTTCTCGAGAAACCCACAAACTAAATCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000094995    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019571.1-862s1c1
Sequence:CCGGGCTGATGATTGGAACCTAAATCTCGAGATTTAGGTTCCAATCATCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000094998    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019571.1-417s1c1
Sequence:CCGGAGTCAGTTGTTGCATCAAATACTCGAGTATTTGATGCAACAACTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000094997    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019571.1-863s1c1
Sequence:CCGGCTGATGATTGGAACCTAAATACTCGAGTATTTAGGTTCCAATCATCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000094996    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019571.1-1112s1c1
Sequence:CCGGGCATTGCATTGCTACAGATTTCTCGAGAAATCTGTAGCAATGCAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_019571
VALIDATED
TSPAN5 MISSION shRNA Lentiviral Transduction Particles
tetraspanin 5
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000094994    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019571.1-2641s1c1
Sequence:CCGGGCAGATTTAGTTTGTGGGTTTCTCGAGAAACCCACAAACTAAATCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000094995    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019571.1-862s1c1
Sequence:CCGGGCTGATGATTGGAACCTAAATCTCGAGATTTAGGTTCCAATCATCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000094998    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019571.1-417s1c1
Sequence:CCGGAGTCAGTTGTTGCATCAAATACTCGAGTATTTGATGCAACAACTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000094997    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019571.1-863s1c1
Sequence:CCGGCTGATGATTGGAACCTAAATACTCGAGTATTTAGGTTCCAATCATCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000094996    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019571.1-1112s1c1
Sequence:CCGGGCATTGCATTGCTACAGATTTCTCGAGAAATCTGTAGCAATGCAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks