EMAIL THIS PAGE TO A FRIEND

TSPAN6

tetraspanin 6

Synonyms: T245 TM4SF6 TSPAN-6
UniProtKB ID: O43657, Q54A42, Q6IAN9
Gene ID:
Human(7105) Summary: The protein encoded by this gene is a member of the transmembrane 4 superfamily, also known as the tetraspanin family. Most of these members are cell-surface proteins that are characterized by the presence of four hydrophobic domains. The proteins mediate signal transduction events that play a role in the regulation of cell development, activation, growth and motility. The protein encoded by this gene is a cell surface glycoprotein and is highly similar in sequence to the transmembrane 4 superfamily member 2 protein. It functions as a negative regulator of retinoic acid-inducible gene I-like receptor-mediated immune signaling via its interaction with the mitochondrial antiviral signaling-centered signalosome. This gene uses alternative polyadenylation sites, and multiple transcript variants result from alternative splicing. [provided by RefSeq, Jul 2013]
Mouse(56496) tetraspanin 6
Rat(302313) tetraspanin 6
chicken(422262) tetraspanin 6
dog(480981) tetraspanin 6
domestic cat(101085355) tetraspanin 6
cow(514741) tetraspanin 6
sheep(101110392) tetraspanin 6
80 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_019656 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_019656 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_019656 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_003270 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003270 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003270 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003270 Rosetta Predictions human pricing
NM_001100672 Rosetta Predictions rat pricing
NM_019656 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003270 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00040229 predicted 382
2 SASI_Hs01_00040231 predicted 836
3 SASI_Hs01_00040232 predicted 624
4 SASI_Hs01_00040234 predicted 841
5 SASI_Hs01_00040235 predicted 924
6 SASI_Hs01_00040236 predicted 578
7 SASI_Hs01_00040237 predicted 576
8 SASI_Hs01_00040238 predicted 804
9 SASI_Hs02_00335326 predicted 614
10 SASI_Hs02_00335327 predicted 458
11 SASI_Hs01_00040230 predicted 465
12 SASI_Hs01_00040233 predicted 754
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001100672 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00210268 predicted 507
2 SASI_Rn02_00210269 predicted 771
3 SASI_Rn02_00210270 predicted 631
4 SASI_Rn02_00210271 predicted 731
5 SASI_Rn02_00210272 predicted 485
6 SASI_Rn02_00210273 predicted 723
7 SASI_Rn02_00210274 predicted 601
8 SASI_Rn02_00210275 predicted 754
9 SASI_Rn02_00210276 predicted 789
10 SASI_Rn02_00210277 predicted 290
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019656 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00074036 predicted 630
2 SASI_Mm01_00074037 predicted 856
3 SASI_Mm01_00074038 predicted 751
4 SASI_Mm01_00074040 predicted 839
5 SASI_Mm01_00074041 predicted 700
6 SASI_Mm02_00324704 predicted 717
7 SASI_Mm02_00324705 predicted 605
8 SASI_Mm01_00074042 predicted 474
9 SASI_Mm01_00074043 predicted 833
10 SASI_Mm01_00074045 predicted 606
11 SASI_Mm01_00074039 predicted 804
12 SASI_Mm01_00074044 predicted 508
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_019656
VALIDATED
TSPAN6 MISSION shRNA Bacterial Glycerol Stock
tetraspanin 6
Mouse
15 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000094629    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_019656.2-917s1c1
Sequence:CCGGGCTGATTCAATCAAGATACTTCTCGAGAAGTATCTTGATTGAATCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000094630    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019656.2-388s1c1
Sequence:CCGGGCCGCCATTGTTGGATTTGTTCTCGAGAACAAATCCAACAATGGCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000094631    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_019656.2-103s1c1
Sequence:CCGGCCGGTCATTACTTGTTTGAAACTCGAGTTTCAAACAAGTAATGACCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000094633    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_019656.2-348s1c1
Sequence:CCGGCGCGATGTTTCTGACACTCATCTCGAGATGAGTGTCAGAAACATCGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000094632    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_019656.2-349s1c1
Sequence:CCGGGCGATGTTTCTGACACTCATTCTCGAGAATGAGTGTCAGAAACATCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000382520    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019656.3-762s21c1
Sequence:GTACCGGGGGAGTCGTTGCTGGAATTTCCTCGAGGAAATTCCAGCAACGACTCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000334151    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019656.3-415s21c1
Sequence:CCGGGCGATGTTTCTGACACTCATTCTCGAGAATGAGTGTCAGAAACATCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000348138    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019656.3-835s21c1
Sequence:CCGGTCTCGTGCCATAACGAATAACCTCGAGGTTATTCGTTATGGCACGAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000363765    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019656.3-983s21c1
Sequence:CCGGGCTGATTCAATCAAGATACTTCTCGAGAAGTATCTTGATTGAATCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000379200    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019656.3-330s21c1
Sequence:CCGGTGGCACAGGCACTGTCATTATCTCGAGATAATGACAGTGCCTGTGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000380222    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019656.3-617s21c1
Sequence:GTACCGGATTGGAAAGGTACGAACTATTCTCGAGAATAGTTCGTACCTTTCCAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000381568    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019656.3-534s21c1
Sequence:GTACCGGCAACTCCACAGGAGACTATAGCTCGAGCTATAGTCTCCTGTGGAGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000334082    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019656.3-169s21c1
Sequence:CCGGCCGGTCATTACTTGTTTGAAACTCGAGTTTCAAACAAGTAATGACCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000382102    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019656.3-592s21c1
Sequence:GTACCGGTGTTGCGGTGTCACCAATTACCTCGAGGTAATTGGTGACACCGCAACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000382448    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019656.3-709s21c1
Sequence:GTACCGGGTCAACGAAGAGGGTTGTTTCCTCGAGGAAACAACCCTCTTCGTTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_019656
VALIDATED
TSPAN6 MISSION shRNA shRNA Plasmid DNA
tetraspanin 6
Mouse
15 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000094629    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_019656.2-917s1c1
Sequence:CCGGGCTGATTCAATCAAGATACTTCTCGAGAAGTATCTTGATTGAATCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000094630    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019656.2-388s1c1
Sequence:CCGGGCCGCCATTGTTGGATTTGTTCTCGAGAACAAATCCAACAATGGCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000094631    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_019656.2-103s1c1
Sequence:CCGGCCGGTCATTACTTGTTTGAAACTCGAGTTTCAAACAAGTAATGACCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000094633    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_019656.2-348s1c1
Sequence:CCGGCGCGATGTTTCTGACACTCATCTCGAGATGAGTGTCAGAAACATCGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000094632    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_019656.2-349s1c1
Sequence:CCGGGCGATGTTTCTGACACTCATTCTCGAGAATGAGTGTCAGAAACATCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000382520    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019656.3-762s21c1
Sequence:GTACCGGGGGAGTCGTTGCTGGAATTTCCTCGAGGAAATTCCAGCAACGACTCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000334151    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019656.3-415s21c1
Sequence:CCGGGCGATGTTTCTGACACTCATTCTCGAGAATGAGTGTCAGAAACATCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000348138    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019656.3-835s21c1
Sequence:CCGGTCTCGTGCCATAACGAATAACCTCGAGGTTATTCGTTATGGCACGAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000363765    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019656.3-983s21c1
Sequence:CCGGGCTGATTCAATCAAGATACTTCTCGAGAAGTATCTTGATTGAATCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000379200    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019656.3-330s21c1
Sequence:CCGGTGGCACAGGCACTGTCATTATCTCGAGATAATGACAGTGCCTGTGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000380222    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019656.3-617s21c1
Sequence:GTACCGGATTGGAAAGGTACGAACTATTCTCGAGAATAGTTCGTACCTTTCCAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000381568    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019656.3-534s21c1
Sequence:GTACCGGCAACTCCACAGGAGACTATAGCTCGAGCTATAGTCTCCTGTGGAGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000334082    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019656.3-169s21c1
Sequence:CCGGCCGGTCATTACTTGTTTGAAACTCGAGTTTCAAACAAGTAATGACCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000382102    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019656.3-592s21c1
Sequence:GTACCGGTGTTGCGGTGTCACCAATTACCTCGAGGTAATTGGTGACACCGCAACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000382448    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019656.3-709s21c1
Sequence:GTACCGGGTCAACGAAGAGGGTTGTTTCCTCGAGGAAACAACCCTCTTCGTTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_019656
VALIDATED
TSPAN6 MISSION shRNA Lentiviral Transduction Particles
tetraspanin 6
Mouse
15 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000094629    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_019656.2-917s1c1
Sequence:CCGGGCTGATTCAATCAAGATACTTCTCGAGAAGTATCTTGATTGAATCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000094630    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019656.2-388s1c1
Sequence:CCGGGCCGCCATTGTTGGATTTGTTCTCGAGAACAAATCCAACAATGGCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000094631    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_019656.2-103s1c1
Sequence:CCGGCCGGTCATTACTTGTTTGAAACTCGAGTTTCAAACAAGTAATGACCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000094633    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_019656.2-348s1c1
Sequence:CCGGCGCGATGTTTCTGACACTCATCTCGAGATGAGTGTCAGAAACATCGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000094632    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_019656.2-349s1c1
Sequence:CCGGGCGATGTTTCTGACACTCATTCTCGAGAATGAGTGTCAGAAACATCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000382520    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019656.3-762s21c1
Sequence:GTACCGGGGGAGTCGTTGCTGGAATTTCCTCGAGGAAATTCCAGCAACGACTCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000334151    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019656.3-415s21c1
Sequence:CCGGGCGATGTTTCTGACACTCATTCTCGAGAATGAGTGTCAGAAACATCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000348138    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019656.3-835s21c1
Sequence:CCGGTCTCGTGCCATAACGAATAACCTCGAGGTTATTCGTTATGGCACGAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000363765    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019656.3-983s21c1
Sequence:CCGGGCTGATTCAATCAAGATACTTCTCGAGAAGTATCTTGATTGAATCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000379200    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019656.3-330s21c1
Sequence:CCGGTGGCACAGGCACTGTCATTATCTCGAGATAATGACAGTGCCTGTGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000380222    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019656.3-617s21c1
Sequence:GTACCGGATTGGAAAGGTACGAACTATTCTCGAGAATAGTTCGTACCTTTCCAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000381568    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019656.3-534s21c1
Sequence:GTACCGGCAACTCCACAGGAGACTATAGCTCGAGCTATAGTCTCCTGTGGAGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000334082    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019656.3-169s21c1
Sequence:CCGGCCGGTCATTACTTGTTTGAAACTCGAGTTTCAAACAAGTAATGACCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000382102    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019656.3-592s21c1
Sequence:GTACCGGTGTTGCGGTGTCACCAATTACCTCGAGGTAATTGGTGACACCGCAACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000382448    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019656.3-709s21c1
Sequence:GTACCGGGTCAACGAAGAGGGTTGTTTCCTCGAGGAAACAACCCTCTTCGTTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003270
VALIDATED
TSPAN6 MISSION shRNA Bacterial Glycerol Stock
tetraspanin 6
Human
17 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000157444    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003270.2-920s1c1
Sequence:CCGGGCTGGAGAACTGACAACACTACTCGAGTAGTGTTGTCAGTTCTCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000153653    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003270.2-154s1c1
Sequence:CCGGCAAGAGCGTTCTGCTAATCTACTCGAGTAGATTAGCAGAACGCTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000152067    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_003270.2-623s1c1
Sequence:CCGGCCTAAGAGTTGCTGTAAACTTCTCGAGAAGTTTACAGCAACTCTTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000150368    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003270.2-769s1c1
Sequence:CCGGCCAACTGATTGGAATCTTTCTCTCGAGAGAAAGATTCCAATCAGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000150937    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_003270.2-484s1c1
Sequence:CCGGGAAGGCTTTGAAGCAGTATAACTCGAGTTATACTGCTTCAAAGCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000152291    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003270.2-497s1c1
Sequence:CCGGCAGTATAACTCTACAGGAGATCTCGAGATCTCCTGTAGAGTTATACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000152829    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003270.2-299s1c1
Sequence:CCGGGCTACTGGTACCGTCATTATTCTCGAGAATAATGACGGTACCAGTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000153171    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_003270.2-383s1c1
Sequence:CCGGGCAATGTTTCTGACTCTCGTTCTCGAGAACGAGAGTCAGAAACATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000380267    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_003270.2-1041s21c1
Sequence:GTACCGGTCGCAGTGGGCTGATTCAATCCTCGAGGATTGAATCAGCCCACTGCGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000379955    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003270.2-698s21c1
Sequence:GTACCGGATAAAGGTGATGACCATTATACTCGAGTATAATGGTCATCACCTTTATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000349721    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003270.2-484s21c1
Sequence:CCGGGAAGGCTTTGAAGCAGTATAACTCGAGTTATACTGCTTCAAAGCCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000379463    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_003270.2-419s21c1
Sequence:GTACCGGGTCGCTGCCATCGTAGGATTTCTCGAGAAATCCTACGATGGCAGCGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000379532    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_003270.2-583s21c1
Sequence:GTACCGGAGATTGGACAGATACTAATTACTCGAGTAATTAGTATCTGTCCAATCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000312422    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003270.2-623s21c1
Sequence:CCGGCCTAAGAGTTGCTGTAAACTTCTCGAGAAGTTTACAGCAACTCTTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000312475    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003270.2-920s21c1
Sequence:CCGGGCTGGAGAACTGACAACACTACTCGAGTAGTGTTGTCAGTTCTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000312473    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003270.2-383s21c1
Sequence:CCGGGCAATGTTTCTGACTCTCGTTCTCGAGAACGAGAGTCAGAAACATTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000381476    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_003270.2-561s21c1
Sequence:GTACCGGGTTGTGGTGTCACCGATTATACTCGAGTATAATCGGTGACACCACAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003270
VALIDATED
TSPAN6 MISSION shRNA shRNA Plasmid DNA
tetraspanin 6
Human
17 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000157444    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003270.2-920s1c1
Sequence:CCGGGCTGGAGAACTGACAACACTACTCGAGTAGTGTTGTCAGTTCTCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000153653    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003270.2-154s1c1
Sequence:CCGGCAAGAGCGTTCTGCTAATCTACTCGAGTAGATTAGCAGAACGCTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000152067    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_003270.2-623s1c1
Sequence:CCGGCCTAAGAGTTGCTGTAAACTTCTCGAGAAGTTTACAGCAACTCTTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000150368    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003270.2-769s1c1
Sequence:CCGGCCAACTGATTGGAATCTTTCTCTCGAGAGAAAGATTCCAATCAGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000150937    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_003270.2-484s1c1
Sequence:CCGGGAAGGCTTTGAAGCAGTATAACTCGAGTTATACTGCTTCAAAGCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000152291    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003270.2-497s1c1
Sequence:CCGGCAGTATAACTCTACAGGAGATCTCGAGATCTCCTGTAGAGTTATACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000152829    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003270.2-299s1c1
Sequence:CCGGGCTACTGGTACCGTCATTATTCTCGAGAATAATGACGGTACCAGTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000153171    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_003270.2-383s1c1
Sequence:CCGGGCAATGTTTCTGACTCTCGTTCTCGAGAACGAGAGTCAGAAACATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000380267    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_003270.2-1041s21c1
Sequence:GTACCGGTCGCAGTGGGCTGATTCAATCCTCGAGGATTGAATCAGCCCACTGCGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000379955    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003270.2-698s21c1
Sequence:GTACCGGATAAAGGTGATGACCATTATACTCGAGTATAATGGTCATCACCTTTATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000349721    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003270.2-484s21c1
Sequence:CCGGGAAGGCTTTGAAGCAGTATAACTCGAGTTATACTGCTTCAAAGCCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000379463    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_003270.2-419s21c1
Sequence:GTACCGGGTCGCTGCCATCGTAGGATTTCTCGAGAAATCCTACGATGGCAGCGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000379532    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_003270.2-583s21c1
Sequence:GTACCGGAGATTGGACAGATACTAATTACTCGAGTAATTAGTATCTGTCCAATCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000312422    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003270.2-623s21c1
Sequence:CCGGCCTAAGAGTTGCTGTAAACTTCTCGAGAAGTTTACAGCAACTCTTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000312475    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003270.2-920s21c1
Sequence:CCGGGCTGGAGAACTGACAACACTACTCGAGTAGTGTTGTCAGTTCTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000312473    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003270.2-383s21c1
Sequence:CCGGGCAATGTTTCTGACTCTCGTTCTCGAGAACGAGAGTCAGAAACATTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000381476    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_003270.2-561s21c1
Sequence:GTACCGGGTTGTGGTGTCACCGATTATACTCGAGTATAATCGGTGACACCACAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003270
VALIDATED
TSPAN6 MISSION shRNA Lentiviral Transduction Particles
tetraspanin 6
Human
17 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000157444    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003270.2-920s1c1
Sequence:CCGGGCTGGAGAACTGACAACACTACTCGAGTAGTGTTGTCAGTTCTCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000153653    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003270.2-154s1c1
Sequence:CCGGCAAGAGCGTTCTGCTAATCTACTCGAGTAGATTAGCAGAACGCTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000152067    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_003270.2-623s1c1
Sequence:CCGGCCTAAGAGTTGCTGTAAACTTCTCGAGAAGTTTACAGCAACTCTTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000150368    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003270.2-769s1c1
Sequence:CCGGCCAACTGATTGGAATCTTTCTCTCGAGAGAAAGATTCCAATCAGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000150937    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_003270.2-484s1c1
Sequence:CCGGGAAGGCTTTGAAGCAGTATAACTCGAGTTATACTGCTTCAAAGCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000152291    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003270.2-497s1c1
Sequence:CCGGCAGTATAACTCTACAGGAGATCTCGAGATCTCCTGTAGAGTTATACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000152829    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003270.2-299s1c1
Sequence:CCGGGCTACTGGTACCGTCATTATTCTCGAGAATAATGACGGTACCAGTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000153171    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_003270.2-383s1c1
Sequence:CCGGGCAATGTTTCTGACTCTCGTTCTCGAGAACGAGAGTCAGAAACATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000380267    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_003270.2-1041s21c1
Sequence:GTACCGGTCGCAGTGGGCTGATTCAATCCTCGAGGATTGAATCAGCCCACTGCGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000379955    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003270.2-698s21c1
Sequence:GTACCGGATAAAGGTGATGACCATTATACTCGAGTATAATGGTCATCACCTTTATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000349721    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003270.2-484s21c1
Sequence:CCGGGAAGGCTTTGAAGCAGTATAACTCGAGTTATACTGCTTCAAAGCCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000379463    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_003270.2-419s21c1
Sequence:GTACCGGGTCGCTGCCATCGTAGGATTTCTCGAGAAATCCTACGATGGCAGCGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000379532    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_003270.2-583s21c1
Sequence:GTACCGGAGATTGGACAGATACTAATTACTCGAGTAATTAGTATCTGTCCAATCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000312422    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003270.2-623s21c1
Sequence:CCGGCCTAAGAGTTGCTGTAAACTTCTCGAGAAGTTTACAGCAACTCTTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000312475    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003270.2-920s21c1
Sequence:CCGGGCTGGAGAACTGACAACACTACTCGAGTAGTGTTGTCAGTTCTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000312473    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003270.2-383s21c1
Sequence:CCGGGCAATGTTTCTGACTCTCGTTCTCGAGAACGAGAGTCAGAAACATTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000381476    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_003270.2-561s21c1
Sequence:GTACCGGGTTGTGGTGTCACCGATTATACTCGAGTATAATCGGTGACACCACAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks