EMAIL THIS PAGE TO A FRIEND

TSPAN7

tetraspanin 7

Synonyms: A15 CCG-B7 CD231 DXS1692E MRX58 MXS1 TALLA-1 TM4SF2 TM4SF2b
UniProtKB ID: P41732, B2R5W7, D3DWB1, Q8WVG5, Q9UEY9
Gene ID:
Human(7102) Summary: The protein encoded by this gene is a member of the transmembrane 4 superfamily, also known as the tetraspanin family. Most of these members are cell-surface proteins that are characterized by the presence of four hydrophobic domains. The proteins mediate signal transduction events that play a role in the regulation of cell development, activation, growth and motility. This encoded protein is a cell surface glycoprotein and may have a role in the control of neurite outgrowth. It is known to complex with integrins. This gene is associated with X-linked mental retardation and neuropsychiatric diseases such as Huntington's chorea, fragile X syndrome and myotonic dystrophy. [provided by RefSeq, Jul 2008]
Mouse(21912) tetraspanin 7
Rat(363447) tetraspanin 7
cow(615596) tetraspanin 7
sheep(101102457) tetraspanin 7
Zebrafish(406802) tetraspanin 7
chicken(418577) tetraspanin 7
domestic cat(101088058) tetraspanin 7
dog(480879) tetraspanin 7
94 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_004615 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004615 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004615 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_019634 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_019634 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_019634 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004615 Rosetta Predictions human pricing
NM_001108815 Rosetta Predictions rat pricing
NM_019634 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004615 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00163295 predicted 455
2 SASI_Hs01_00163297 predicted 660
3 SASI_Hs01_00163298 predicted 894
4 SASI_Hs01_00163299 predicted 824
5 SASI_Hs01_00163302 predicted 1257
6 SASI_Hs02_00338008 predicted 380
7 SASI_Hs02_00338009 predicted 1208
8 SASI_Hs01_00163303 predicted 596
9 SASI_Hs01_00163304 predicted 803
10 SASI_Hs02_00338010 predicted 784
11 SASI_Hs01_00163296 predicted 683
12 SASI_Hs01_00163300 predicted 266
13 SASI_Hs01_00163301 predicted 885
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108815 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00242345 predicted 746
2 SASI_Rn02_00242346 predicted 551
3 SASI_Rn02_00242347 predicted 752
4 SASI_Rn02_00242348 predicted 389
5 SASI_Rn02_00242349 predicted 212
6 SASI_Rn02_00242350 predicted 684
7 SASI_Rn02_00242351 predicted 534
8 SASI_Rn02_00242352 predicted 870
9 SASI_Rn02_00242353 predicted 879
10 SASI_Rn02_00242354 predicted 732
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019634 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00076611 predicted 393
2 SASI_Mm01_00076612 predicted 1287
3 SASI_Mm01_00076613 predicted 1220
4 SASI_Mm01_00076615 predicted 285
5 SASI_Mm01_00076616 predicted 340
6 SASI_Mm01_00076617 predicted 1190
7 SASI_Mm01_00076618 predicted 586
8 SASI_Mm01_00076619 predicted 1220
9 SASI_Mm01_00076620 predicted 339
10 SASI_Mm02_00324665 predicted 408
11 SASI_Mm01_00076614 predicted 612
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004615
VALIDATED
TSPAN7 MISSION shRNA Bacterial Glycerol Stock
tetraspanin 7
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000382099    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_004615.3-192s21c1
Sequence:GTACCGGACTTACTCTGGGCACCTATATCTCGAGATATAGGTGCCCAGAGTAAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000379931    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004615.3-1233s21c1
Sequence:GTACCGGGTAAATGCCACACACCTTTAACTCGAGTTAAAGGTGTGTGGCATTTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000379786    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004615.3-655s21c1
Sequence:GTACCGGGTTAACCAGAAGGGTTGTTATCTCGAGATAACAACCCTTCTGGTTAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000379967    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004615.3-446s21c1
Sequence:GTACCGGACGCTATGCAGACTTACAATGCTCGAGCATTGTAAGTCTGCATAGCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000118807    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004615.2-1436s1c1
Sequence:CCGGGCTTGTTACATACCTGGGTATCTCGAGATACCCAGGTATGTAACAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000118808    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A3
TRC Version: 1 Clone ID:NM_004615.2-279s1c1
Sequence:CCGGGCCTGTTTGGATGCTTTGCTACTCGAGTAGCAAAGCATCCAAACAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000118809    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A3
TRC Version: 1 Clone ID:NM_004615.2-585s1c1
Sequence:CCGGGCATGAACGAAACTGATTGTACTCGAGTACAATCAGTTTCGTTCATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000118810    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A3
TRC Version: 1 Clone ID:NM_004615.2-657s1c1
Sequence:CCGGAGGGTTGTTATGATCTGGTAACTCGAGTTACCAGATCATAACAACCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000118811    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A3
TRC Version: 1 Clone ID:NM_004615.2-445s1c1
Sequence:CCGGGCAGACTTACAATGGCAATGACTCGAGTCATTGCCATTGTAAGTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004615
VALIDATED
TSPAN7 MISSION shRNA shRNA Plasmid DNA
tetraspanin 7
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000382099    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_004615.3-192s21c1
Sequence:GTACCGGACTTACTCTGGGCACCTATATCTCGAGATATAGGTGCCCAGAGTAAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000379931    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004615.3-1233s21c1
Sequence:GTACCGGGTAAATGCCACACACCTTTAACTCGAGTTAAAGGTGTGTGGCATTTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000379786    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004615.3-655s21c1
Sequence:GTACCGGGTTAACCAGAAGGGTTGTTATCTCGAGATAACAACCCTTCTGGTTAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000379967    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004615.3-446s21c1
Sequence:GTACCGGACGCTATGCAGACTTACAATGCTCGAGCATTGTAAGTCTGCATAGCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000118807    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004615.2-1436s1c1
Sequence:CCGGGCTTGTTACATACCTGGGTATCTCGAGATACCCAGGTATGTAACAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000118808    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A3
TRC Version: 1 Clone ID:NM_004615.2-279s1c1
Sequence:CCGGGCCTGTTTGGATGCTTTGCTACTCGAGTAGCAAAGCATCCAAACAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000118809    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A3
TRC Version: 1 Clone ID:NM_004615.2-585s1c1
Sequence:CCGGGCATGAACGAAACTGATTGTACTCGAGTACAATCAGTTTCGTTCATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000118810    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A3
TRC Version: 1 Clone ID:NM_004615.2-657s1c1
Sequence:CCGGAGGGTTGTTATGATCTGGTAACTCGAGTTACCAGATCATAACAACCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000118811    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A3
TRC Version: 1 Clone ID:NM_004615.2-445s1c1
Sequence:CCGGGCAGACTTACAATGGCAATGACTCGAGTCATTGCCATTGTAAGTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004615
VALIDATED
TSPAN7 MISSION shRNA Lentiviral Transduction Particles
tetraspanin 7
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000382099    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_004615.3-192s21c1
Sequence:GTACCGGACTTACTCTGGGCACCTATATCTCGAGATATAGGTGCCCAGAGTAAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000379931    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004615.3-1233s21c1
Sequence:GTACCGGGTAAATGCCACACACCTTTAACTCGAGTTAAAGGTGTGTGGCATTTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000379786    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004615.3-655s21c1
Sequence:GTACCGGGTTAACCAGAAGGGTTGTTATCTCGAGATAACAACCCTTCTGGTTAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000379967    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004615.3-446s21c1
Sequence:GTACCGGACGCTATGCAGACTTACAATGCTCGAGCATTGTAAGTCTGCATAGCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000118807    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004615.2-1436s1c1
Sequence:CCGGGCTTGTTACATACCTGGGTATCTCGAGATACCCAGGTATGTAACAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000118808    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A3
TRC Version: 1 Clone ID:NM_004615.2-279s1c1
Sequence:CCGGGCCTGTTTGGATGCTTTGCTACTCGAGTAGCAAAGCATCCAAACAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000118809    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A3
TRC Version: 1 Clone ID:NM_004615.2-585s1c1
Sequence:CCGGGCATGAACGAAACTGATTGTACTCGAGTACAATCAGTTTCGTTCATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000118810    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A3
TRC Version: 1 Clone ID:NM_004615.2-657s1c1
Sequence:CCGGAGGGTTGTTATGATCTGGTAACTCGAGTTACCAGATCATAACAACCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000118811    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A3
TRC Version: 1 Clone ID:NM_004615.2-445s1c1
Sequence:CCGGGCAGACTTACAATGGCAATGACTCGAGTCATTGCCATTGTAAGTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_019634
VALIDATED
TSPAN7 MISSION shRNA Bacterial Glycerol Stock
tetraspanin 7
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000327523    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019634.2-165s21c1
Sequence:CCGGGCTGACTTTGGGAACCTATATCTCGAGATATAGGTTCCCAAAGTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000327524    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019634.2-1229s21c1
Sequence:CCGGCCGTAGATATGCCGATGGTAACTCGAGTTACCATCGGCATATCTACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000327607    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019634.2-628s21c1
Sequence:CCGGGTTAATCAGAAGGGCTGTTATCTCGAGATAACAGCCCTTCTGATTAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000327606    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019634.2-418s21c1
Sequence:CCGGGATGCCATGCAGAACTACAATCTCGAGATTGTAGTTCTGCATGGCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000094344    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_019634.1-1177s1c1
Sequence:CCGGCCGTAGATATGCCGATGGTAACTCGAGTTACCATCGGCATATCTACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000094346    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019634.1-576s1c1
Sequence:CCGGGTTAATCAGAAGGGCTGTTATCTCGAGATAACAGCCCTTCTGATTAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000094348    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019634.1-366s1c1
Sequence:CCGGGATGCCATGCAGAACTACAATCTCGAGATTGTAGTTCTGCATGGCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000094347    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019634.1-371s1c1
Sequence:CCGGCATGCAGAACTACAATGGCAACTCGAGTTGCCATTGTAGTTCTGCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000094345    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019634.1-113s1c1
Sequence:CCGGGCTGACTTTGGGAACCTATATCTCGAGATATAGGTTCCCAAAGTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_019634
VALIDATED
TSPAN7 MISSION shRNA shRNA Plasmid DNA
tetraspanin 7
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000327523    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019634.2-165s21c1
Sequence:CCGGGCTGACTTTGGGAACCTATATCTCGAGATATAGGTTCCCAAAGTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000327524    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019634.2-1229s21c1
Sequence:CCGGCCGTAGATATGCCGATGGTAACTCGAGTTACCATCGGCATATCTACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000327607    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019634.2-628s21c1
Sequence:CCGGGTTAATCAGAAGGGCTGTTATCTCGAGATAACAGCCCTTCTGATTAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000327606    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019634.2-418s21c1
Sequence:CCGGGATGCCATGCAGAACTACAATCTCGAGATTGTAGTTCTGCATGGCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000094344    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_019634.1-1177s1c1
Sequence:CCGGCCGTAGATATGCCGATGGTAACTCGAGTTACCATCGGCATATCTACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000094346    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019634.1-576s1c1
Sequence:CCGGGTTAATCAGAAGGGCTGTTATCTCGAGATAACAGCCCTTCTGATTAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000094348    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019634.1-366s1c1
Sequence:CCGGGATGCCATGCAGAACTACAATCTCGAGATTGTAGTTCTGCATGGCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000094347    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019634.1-371s1c1
Sequence:CCGGCATGCAGAACTACAATGGCAACTCGAGTTGCCATTGTAGTTCTGCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000094345    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019634.1-113s1c1
Sequence:CCGGGCTGACTTTGGGAACCTATATCTCGAGATATAGGTTCCCAAAGTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_019634
VALIDATED
TSPAN7 MISSION shRNA Lentiviral Transduction Particles
tetraspanin 7
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000327523    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019634.2-165s21c1
Sequence:CCGGGCTGACTTTGGGAACCTATATCTCGAGATATAGGTTCCCAAAGTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000327524    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019634.2-1229s21c1
Sequence:CCGGCCGTAGATATGCCGATGGTAACTCGAGTTACCATCGGCATATCTACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000327607    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019634.2-628s21c1
Sequence:CCGGGTTAATCAGAAGGGCTGTTATCTCGAGATAACAGCCCTTCTGATTAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000327606    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019634.2-418s21c1
Sequence:CCGGGATGCCATGCAGAACTACAATCTCGAGATTGTAGTTCTGCATGGCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000094344    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_019634.1-1177s1c1
Sequence:CCGGCCGTAGATATGCCGATGGTAACTCGAGTTACCATCGGCATATCTACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000094346    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019634.1-576s1c1
Sequence:CCGGGTTAATCAGAAGGGCTGTTATCTCGAGATAACAGCCCTTCTGATTAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000094348    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019634.1-366s1c1
Sequence:CCGGGATGCCATGCAGAACTACAATCTCGAGATTGTAGTTCTGCATGGCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000094347    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019634.1-371s1c1
Sequence:CCGGCATGCAGAACTACAATGGCAACTCGAGTTGCCATTGTAGTTCTGCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000094345    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019634.1-113s1c1
Sequence:CCGGGCTGACTTTGGGAACCTATATCTCGAGATATAGGTTCCCAAAGTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks