EMAIL THIS PAGE TO A FRIEND

TSPAN8

tetraspanin 8

Synonyms: CO-029 TM4SF3
UniProtKB ID: P19075, B2R7T7, Q9BS78
Gene ID:
Human(7103) Summary: The protein encoded by this gene is a member of the transmembrane 4 superfamily, also known as the tetraspanin family. Most of these members are cell-surface proteins that are characterized by the presence of four hydrophobic domains. The proteins mediate signal transduction events that play a role in the regulation of cell development, activation, growth and motility. This encoded protein is a cell surface glycoprotein that is known to complex with integrins. This gene is expressed in different carcinomas. The use of alternate polyadenylation sites has been found for this gene. [provided by RefSeq, Jul 2008]
Mouse(216350) tetraspanin 8
Rat(171048) tetraspanin 8
chicken(417854) tetraspanin 8
dog(474448) tetraspanin 8
domestic cat(101101146) tetraspanin 8
cow(617508) tetraspanin 8
sheep(101119291) tetraspanin 8
83 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_146010 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_146010 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_146010 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_004616 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004616 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004616 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004616 Rosetta Predictions human pricing
NM_133526 Rosetta Predictions rat pricing
NM_146010 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004616 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00077318 predicted 615
2 SASI_Hs02_00338011 predicted 512
3 SASI_Hs01_00077319 predicted 239
4 SASI_Hs01_00077320 predicted 592
5 SASI_Hs01_00077321 predicted 325
6 SASI_Hs01_00077322 predicted 753
7 SASI_Hs01_00077324 predicted 597
8 SASI_Hs01_00077326 predicted 739
9 SASI_Hs01_00077327 predicted 810
10 SASI_Hs02_00338012 predicted 527
11 SASI_Hs01_00077323 predicted 840
12 SASI_Hs01_00077325 predicted 800
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133526 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00062440 predicted 800
2 SASI_Rn01_00062441 predicted 301
3 SASI_Rn01_00062443 predicted 300
4 SASI_Rn01_00062444 predicted 649
5 SASI_Rn01_00062445 predicted 767
6 SASI_Rn01_00062446 predicted 737
7 SASI_Rn01_00062447 predicted 858
8 SASI_Rn01_00062448 predicted 899
9 SASI_Rn02_00267706 predicted 650
10 SASI_Rn02_00267707 predicted 534
11 SASI_Rn01_00062442 predicted 565
12 SASI_Rn01_00062449 predicted 833
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_146010 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00135613 predicted 635
2 SASI_Mm01_00135614 predicted 837
3 SASI_Mm01_00135615 predicted 640
4 SASI_Mm01_00135617 predicted 879
5 SASI_Mm01_00135618 predicted 702
6 SASI_Mm02_00341561 predicted 739
7 SASI_Mm02_00341562 predicted 413
8 SASI_Mm01_00135620 predicted 875
9 SASI_Mm01_00135621 predicted 400
10 SASI_Mm01_00135622 predicted 372
11 SASI_Mm01_00135616 predicted 723
12 SASI_Mm01_00135619 predicted 392
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_146010
VALIDATED
TSPAN8 MISSION shRNA Bacterial Glycerol Stock
tetraspanin 8
Mouse
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000094474    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146010.1-1026s1c1
Sequence:CCGGCCTGAGGATTTACCTAGTCATCTCGAGATGACTAGGTAAATCCTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000094478    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146010.1-560s1c1
Sequence:CCGGCGGTGCATGCTTCTCTTGTTTCTCGAGAAACAAGAGAAGCATGCACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000094475    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146010.1-635s1c1
Sequence:CCGGGCCGCTTTCAAACCTGAGTATCTCGAGATACTCAGGTTTGAAAGCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000094477    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146010.1-634s1c1
Sequence:CCGGAGCCGCTTTCAAACCTGAGTACTCGAGTACTCAGGTTTGAAAGCGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000094476    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146010.1-961s1c1
Sequence:CCGGCGTTATTGAGATTCTCGGTTTCTCGAGAAACCGAGAATCTCAATAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000326871    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146010.1-634s21c1
Sequence:CCGGAGCCGCTTTCAAACCTGAGTACTCGAGTACTCAGGTTTGAAAGCGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000326863    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146010.1-560s21c1
Sequence:CCGGCGGTGCATGCTTCTCTTGTTTCTCGAGAAACAAGAGAAGCATGCACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000326891    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_146010.1-1026s21c1
Sequence:CCGGCCTGAGGATTTACCTAGTCATCTCGAGATGACTAGGTAAATCCTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000379762    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_146010.1-663s21c1
Sequence:GTACCGGTTCTGAATGAAACGCTATATGCTCGAGCATATAGCGTTTCATTCAGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000379788    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_146010.1-390s21c1
Sequence:GTACCGGTGATCTTGGGACTGGCCATATCTCGAGATATGGCCAGTCCCAAGATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000326796    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_146010.1-961s21c1
Sequence:CCGGCGTTATTGAGATTCTCGGTTTCTCGAGAAACCGAGAATCTCAATAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000381775    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_146010.1-842s21c1
Sequence:GTACCGGGGAACTGACTGTGCAACTTATCTCGAGATAAGTTGCACAGTCAGTTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_146010
VALIDATED
TSPAN8 MISSION shRNA shRNA Plasmid DNA
tetraspanin 8
Mouse
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000094474    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146010.1-1026s1c1
Sequence:CCGGCCTGAGGATTTACCTAGTCATCTCGAGATGACTAGGTAAATCCTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000094478    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146010.1-560s1c1
Sequence:CCGGCGGTGCATGCTTCTCTTGTTTCTCGAGAAACAAGAGAAGCATGCACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000094475    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146010.1-635s1c1
Sequence:CCGGGCCGCTTTCAAACCTGAGTATCTCGAGATACTCAGGTTTGAAAGCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000094477    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146010.1-634s1c1
Sequence:CCGGAGCCGCTTTCAAACCTGAGTACTCGAGTACTCAGGTTTGAAAGCGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000094476    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146010.1-961s1c1
Sequence:CCGGCGTTATTGAGATTCTCGGTTTCTCGAGAAACCGAGAATCTCAATAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000326871    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146010.1-634s21c1
Sequence:CCGGAGCCGCTTTCAAACCTGAGTACTCGAGTACTCAGGTTTGAAAGCGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000326863    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146010.1-560s21c1
Sequence:CCGGCGGTGCATGCTTCTCTTGTTTCTCGAGAAACAAGAGAAGCATGCACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000326891    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_146010.1-1026s21c1
Sequence:CCGGCCTGAGGATTTACCTAGTCATCTCGAGATGACTAGGTAAATCCTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000379762    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_146010.1-663s21c1
Sequence:GTACCGGTTCTGAATGAAACGCTATATGCTCGAGCATATAGCGTTTCATTCAGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000379788    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_146010.1-390s21c1
Sequence:GTACCGGTGATCTTGGGACTGGCCATATCTCGAGATATGGCCAGTCCCAAGATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000326796    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_146010.1-961s21c1
Sequence:CCGGCGTTATTGAGATTCTCGGTTTCTCGAGAAACCGAGAATCTCAATAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000381775    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_146010.1-842s21c1
Sequence:GTACCGGGGAACTGACTGTGCAACTTATCTCGAGATAAGTTGCACAGTCAGTTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_146010
VALIDATED
TSPAN8 MISSION shRNA Lentiviral Transduction Particles
tetraspanin 8
Mouse
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000094474    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146010.1-1026s1c1
Sequence:CCGGCCTGAGGATTTACCTAGTCATCTCGAGATGACTAGGTAAATCCTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000094478    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146010.1-560s1c1
Sequence:CCGGCGGTGCATGCTTCTCTTGTTTCTCGAGAAACAAGAGAAGCATGCACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000094475    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146010.1-635s1c1
Sequence:CCGGGCCGCTTTCAAACCTGAGTATCTCGAGATACTCAGGTTTGAAAGCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000094477    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_146010.1-634s1c1
Sequence:CCGGAGCCGCTTTCAAACCTGAGTACTCGAGTACTCAGGTTTGAAAGCGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000094476    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146010.1-961s1c1
Sequence:CCGGCGTTATTGAGATTCTCGGTTTCTCGAGAAACCGAGAATCTCAATAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000326871    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146010.1-634s21c1
Sequence:CCGGAGCCGCTTTCAAACCTGAGTACTCGAGTACTCAGGTTTGAAAGCGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000326863    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146010.1-560s21c1
Sequence:CCGGCGGTGCATGCTTCTCTTGTTTCTCGAGAAACAAGAGAAGCATGCACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000326891    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_146010.1-1026s21c1
Sequence:CCGGCCTGAGGATTTACCTAGTCATCTCGAGATGACTAGGTAAATCCTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000379762    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_146010.1-663s21c1
Sequence:GTACCGGTTCTGAATGAAACGCTATATGCTCGAGCATATAGCGTTTCATTCAGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000379788    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_146010.1-390s21c1
Sequence:GTACCGGTGATCTTGGGACTGGCCATATCTCGAGATATGGCCAGTCCCAAGATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000326796    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_146010.1-961s21c1
Sequence:CCGGCGTTATTGAGATTCTCGGTTTCTCGAGAAACCGAGAATCTCAATAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000381775    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_146010.1-842s21c1
Sequence:GTACCGGGGAACTGACTGTGCAACTTATCTCGAGATAAGTTGCACAGTCAGTTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004616
TSPAN8 MISSION shRNA Bacterial Glycerol Stock
tetraspanin 8
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000119112    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004616.2-905s1c1
Sequence:CCGGCATCAACCTATCGTCAGTCAACTCGAGTTGACTGACGATAGGTTGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000119115    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004616.2-342s1c1
Sequence:CCGGGCTGTGGACATATTGATTGCTCTCGAGAGCAATCAATATGTCCACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000119116    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004616.2-517s1c1
Sequence:CCGGCTGATCGCATTGTGAATGAAACTCGAGTTTCATTCACAATGCGATCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000119113    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004616.2-334s1c1
Sequence:CCGGCCTACGTTGCTGTGGACATATCTCGAGATATGTCCACAGCAACGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000119114    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004616.2-279s1c1
Sequence:CCGGCGAGTAAGCAATGACTCTCAACTCGAGTTGAGAGTCATTGCTTACTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000382459    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004616.2-395s21c1
Sequence:GTACCGGGGGATGCTGCGGTGCTATAAACTCGAGTTTATAGCACCGCAGCATCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000379690    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004616.2-608s21c1
Sequence:GTACCGGTGTGTTTCAAGAAGAGTTTAACTCGAGTTAAACTCTTCTTGAAACACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000380006    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004616.2-817s21c1
Sequence:GTACCGGCATTTGGACTGGCAGTTATTGCTCGAGCAATAACTGCCAGTCCAAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000380428    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004616.2-518s21c1
Sequence:GTACCGGTGATCGCATTGTGAATGAAACCTCGAGGTTTCATTCACAATGCGATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000382251    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004616.2-714s21c1
Sequence:GTACCGGAGACCATGCCAAAGCTATAATCTCGAGATTATAGCTTTGGCATGGTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000381474    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004616.2-266s21c1
Sequence:GTACCGGAGCAATATGGGTACGAGTAAGCTCGAGCTTACTCGTACCCATATTGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004616
TSPAN8 MISSION shRNA shRNA Plasmid DNA
tetraspanin 8
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000119112    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004616.2-905s1c1
Sequence:CCGGCATCAACCTATCGTCAGTCAACTCGAGTTGACTGACGATAGGTTGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000119115    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004616.2-342s1c1
Sequence:CCGGGCTGTGGACATATTGATTGCTCTCGAGAGCAATCAATATGTCCACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000119116    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004616.2-517s1c1
Sequence:CCGGCTGATCGCATTGTGAATGAAACTCGAGTTTCATTCACAATGCGATCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000119113    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004616.2-334s1c1
Sequence:CCGGCCTACGTTGCTGTGGACATATCTCGAGATATGTCCACAGCAACGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000119114    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004616.2-279s1c1
Sequence:CCGGCGAGTAAGCAATGACTCTCAACTCGAGTTGAGAGTCATTGCTTACTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000382459    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004616.2-395s21c1
Sequence:GTACCGGGGGATGCTGCGGTGCTATAAACTCGAGTTTATAGCACCGCAGCATCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000379690    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004616.2-608s21c1
Sequence:GTACCGGTGTGTTTCAAGAAGAGTTTAACTCGAGTTAAACTCTTCTTGAAACACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000380006    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004616.2-817s21c1
Sequence:GTACCGGCATTTGGACTGGCAGTTATTGCTCGAGCAATAACTGCCAGTCCAAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000380428    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004616.2-518s21c1
Sequence:GTACCGGTGATCGCATTGTGAATGAAACCTCGAGGTTTCATTCACAATGCGATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000382251    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004616.2-714s21c1
Sequence:GTACCGGAGACCATGCCAAAGCTATAATCTCGAGATTATAGCTTTGGCATGGTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000381474    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004616.2-266s21c1
Sequence:GTACCGGAGCAATATGGGTACGAGTAAGCTCGAGCTTACTCGTACCCATATTGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004616
TSPAN8 MISSION shRNA Lentiviral Transduction Particles
tetraspanin 8
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000119112    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004616.2-905s1c1
Sequence:CCGGCATCAACCTATCGTCAGTCAACTCGAGTTGACTGACGATAGGTTGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000119115    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004616.2-342s1c1
Sequence:CCGGGCTGTGGACATATTGATTGCTCTCGAGAGCAATCAATATGTCCACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000119116    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004616.2-517s1c1
Sequence:CCGGCTGATCGCATTGTGAATGAAACTCGAGTTTCATTCACAATGCGATCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000119113    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004616.2-334s1c1
Sequence:CCGGCCTACGTTGCTGTGGACATATCTCGAGATATGTCCACAGCAACGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000119114    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004616.2-279s1c1
Sequence:CCGGCGAGTAAGCAATGACTCTCAACTCGAGTTGAGAGTCATTGCTTACTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000382459    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004616.2-395s21c1
Sequence:GTACCGGGGGATGCTGCGGTGCTATAAACTCGAGTTTATAGCACCGCAGCATCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000379690    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004616.2-608s21c1
Sequence:GTACCGGTGTGTTTCAAGAAGAGTTTAACTCGAGTTAAACTCTTCTTGAAACACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000380006    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004616.2-817s21c1
Sequence:GTACCGGCATTTGGACTGGCAGTTATTGCTCGAGCAATAACTGCCAGTCCAAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000380428    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004616.2-518s21c1
Sequence:GTACCGGTGATCGCATTGTGAATGAAACCTCGAGGTTTCATTCACAATGCGATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000382251    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004616.2-714s21c1
Sequence:GTACCGGAGACCATGCCAAAGCTATAATCTCGAGATTATAGCTTTGGCATGGTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000381474    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004616.2-266s21c1
Sequence:GTACCGGAGCAATATGGGTACGAGTAAGCTCGAGCTTACTCGTACCCATATTGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks