EMAIL THIS PAGE TO A FRIEND

TSPAN9

tetraspanin 9

Synonyms: NET-5 NET5 PP1057
UniProtKB ID: O75954, D3DUQ7, Q53FV2, Q6FGJ8
Gene ID:
Human(10867) Summary: The protein encoded by this gene is a member of the transmembrane 4 superfamily, also known as the tetraspanin family. Most of these members are cell-surface proteins that are characterized by the presence of four hydrophobic domains. The proteins mediate signal transduction events that play a role in the regulation of cell development, activation, growth and motility. Alternatively spliced transcripts encoding the same protein have been identified. [provided by RefSeq, Nov 2009]
Mouse(109246) tetraspanin 9
Rat(312728) tetraspanin 9
cow(540132) tetraspanin 9
chicken(418263) tetraspanin 9
dog(612996) tetraspanin 9
domestic cat(101090195) tetraspanin 9
98 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_175414 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_175414 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_175414 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_006675 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006675 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006675 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU032601 MISSION® esiRNA esiRNA human TSPAN9 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006675 Rosetta Predictions human pricing
NM_001107890 Rosetta Predictions rat pricing
NM_175414 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006675 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00055203 predicted 427
2 SASI_Hs01_00055204 predicted 301
3 SASI_Hs02_00342076 predicted 306
4 SASI_Hs01_00055206 predicted 726
5 SASI_Hs01_00055207 predicted 427
6 SASI_Hs01_00055208 predicted 439
7 SASI_Hs02_00342077 predicted 308
8 SASI_Hs01_00055209 predicted 284
9 SASI_Hs01_00055210 predicted 703
10 SASI_Hs01_00055211 predicted 290
11 SASI_Hs01_00055202 predicted 550
12 SASI_Hs01_00055205 predicted 596
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107890 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00233285 predicted 1273
2 SASI_Rn02_00233286 predicted 725
3 SASI_Rn02_00233287 predicted 527
4 SASI_Rn02_00233288 predicted 296
5 SASI_Rn02_00233289 predicted 949
6 SASI_Rn02_00233290 predicted 1287
7 SASI_Rn02_00233291 predicted 602
8 SASI_Rn02_00233292 predicted 887
9 SASI_Rn02_00233293 predicted 945
10 SASI_Rn02_00233294 predicted 200
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_175414 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00346287 predicted 863
2 SASI_Mm01_00186486 predicted 1057
3 SASI_Mm02_00346288 predicted 1077
4 SASI_Mm01_00186488 predicted 733
5 SASI_Mm01_00186489 predicted 803
6 SASI_Mm01_00186490 predicted 844
7 SASI_Mm01_00186491 predicted 342
8 SASI_Mm01_00186494 predicted 819
9 SASI_Mm02_00346289 predicted 766
10 SASI_Mm02_00346290 predicted 586
11 SASI_Mm01_00186485 predicted 218
12 SASI_Mm01_00186487 predicted 429
13 SASI_Mm01_00186492 predicted 1111
14 SASI_Mm01_00186493 predicted 764
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_175414
VALIDATED
TSPAN9 MISSION shRNA Bacterial Glycerol Stock
tetraspanin 9
Mouse
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000382021    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175414.4-442s21c1
Sequence:GTACCGGTCATCGTGCTGTTGATCATCCCTCGAGGGATGATCAACAGCACGATGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000325584    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_175414.4-1204s21c1
Sequence:CCGGCACACTGACACTTGTTCCTATCTCGAGATAGGAACAAGTGTCAGTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000325509    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175414.4-767s21c1
Sequence:CCGGGCTGTGGTTTGATGACAACAACTCGAGTTGTTGTCATCAAACCACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000325510    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175414.4-212s21c1
Sequence:CCGGGTACACGATGTTCCTCTTCAACTCGAGTTGAAGAGGAACATCGTGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000325508    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175414.4-464s21c1
Sequence:CCGGGCTGGCAGAGTTGATTCTGATCTCGAGATCAGAATCAACTCTGCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000380885    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175414.4-505s21c1
Sequence:GTACCGGTGGACAAGGTGAACGAGAATGCTCGAGCATTCTCGTTCACCTTGTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000381466    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175414.4-596s21c1
Sequence:GTACCGGGAACATCATCCAGGCCGAGATCTCGAGATCTCGGCCTGGATGATGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000381983    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175414.4-867s21c1
Sequence:GTACCGGCACATCCACCGGACAGGTAAACTCGAGTTTACCTGTCCGGTGGATGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000094959    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175414.2-1177s1c1
Sequence:CCGGCACACTGACACTTGTTCCTATCTCGAGATAGGAACAAGTGTCAGTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000094962    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175414.2-185s1c1
Sequence:CCGGGTACACGATGTTCCTCTTCAACTCGAGTTGAAGAGGAACATCGTGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000094963    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175414.2-794s1c1
Sequence:CCGGCATCATGCAGATCCTGGGAATCTCGAGATTCCCAGGATCTGCATGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000094961    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175414.2-740s1c1
Sequence:CCGGGCTGTGGTTTGATGACAACAACTCGAGTTGTTGTCATCAAACCACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000094960    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175414.2-437s1c1
Sequence:CCGGGCTGGCAGAGTTGATTCTGATCTCGAGATCAGAATCAACTCTGCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_175414
VALIDATED
TSPAN9 MISSION shRNA shRNA Plasmid DNA
tetraspanin 9
Mouse
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000382021    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175414.4-442s21c1
Sequence:GTACCGGTCATCGTGCTGTTGATCATCCCTCGAGGGATGATCAACAGCACGATGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000325584    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_175414.4-1204s21c1
Sequence:CCGGCACACTGACACTTGTTCCTATCTCGAGATAGGAACAAGTGTCAGTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000325509    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175414.4-767s21c1
Sequence:CCGGGCTGTGGTTTGATGACAACAACTCGAGTTGTTGTCATCAAACCACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000325510    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175414.4-212s21c1
Sequence:CCGGGTACACGATGTTCCTCTTCAACTCGAGTTGAAGAGGAACATCGTGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000325508    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175414.4-464s21c1
Sequence:CCGGGCTGGCAGAGTTGATTCTGATCTCGAGATCAGAATCAACTCTGCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000380885    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175414.4-505s21c1
Sequence:GTACCGGTGGACAAGGTGAACGAGAATGCTCGAGCATTCTCGTTCACCTTGTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000381466    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175414.4-596s21c1
Sequence:GTACCGGGAACATCATCCAGGCCGAGATCTCGAGATCTCGGCCTGGATGATGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000381983    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175414.4-867s21c1
Sequence:GTACCGGCACATCCACCGGACAGGTAAACTCGAGTTTACCTGTCCGGTGGATGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000094959    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175414.2-1177s1c1
Sequence:CCGGCACACTGACACTTGTTCCTATCTCGAGATAGGAACAAGTGTCAGTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000094962    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175414.2-185s1c1
Sequence:CCGGGTACACGATGTTCCTCTTCAACTCGAGTTGAAGAGGAACATCGTGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000094963    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175414.2-794s1c1
Sequence:CCGGCATCATGCAGATCCTGGGAATCTCGAGATTCCCAGGATCTGCATGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000094961    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175414.2-740s1c1
Sequence:CCGGGCTGTGGTTTGATGACAACAACTCGAGTTGTTGTCATCAAACCACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000094960    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175414.2-437s1c1
Sequence:CCGGGCTGGCAGAGTTGATTCTGATCTCGAGATCAGAATCAACTCTGCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_175414
VALIDATED
TSPAN9 MISSION shRNA Lentiviral Transduction Particles
tetraspanin 9
Mouse
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000382021    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175414.4-442s21c1
Sequence:GTACCGGTCATCGTGCTGTTGATCATCCCTCGAGGGATGATCAACAGCACGATGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000325584    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_175414.4-1204s21c1
Sequence:CCGGCACACTGACACTTGTTCCTATCTCGAGATAGGAACAAGTGTCAGTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000325509    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175414.4-767s21c1
Sequence:CCGGGCTGTGGTTTGATGACAACAACTCGAGTTGTTGTCATCAAACCACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000325510    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175414.4-212s21c1
Sequence:CCGGGTACACGATGTTCCTCTTCAACTCGAGTTGAAGAGGAACATCGTGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000325508    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175414.4-464s21c1
Sequence:CCGGGCTGGCAGAGTTGATTCTGATCTCGAGATCAGAATCAACTCTGCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000380885    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175414.4-505s21c1
Sequence:GTACCGGTGGACAAGGTGAACGAGAATGCTCGAGCATTCTCGTTCACCTTGTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000381466    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175414.4-596s21c1
Sequence:GTACCGGGAACATCATCCAGGCCGAGATCTCGAGATCTCGGCCTGGATGATGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000381983    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175414.4-867s21c1
Sequence:GTACCGGCACATCCACCGGACAGGTAAACTCGAGTTTACCTGTCCGGTGGATGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000094959    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175414.2-1177s1c1
Sequence:CCGGCACACTGACACTTGTTCCTATCTCGAGATAGGAACAAGTGTCAGTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000094962    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175414.2-185s1c1
Sequence:CCGGGTACACGATGTTCCTCTTCAACTCGAGTTGAAGAGGAACATCGTGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000094963    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175414.2-794s1c1
Sequence:CCGGCATCATGCAGATCCTGGGAATCTCGAGATTCCCAGGATCTGCATGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000094961    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175414.2-740s1c1
Sequence:CCGGGCTGTGGTTTGATGACAACAACTCGAGTTGTTGTCATCAAACCACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000094960    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175414.2-437s1c1
Sequence:CCGGGCTGGCAGAGTTGATTCTGATCTCGAGATCAGAATCAACTCTGCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006675
VALIDATED
TSPAN9 MISSION shRNA Bacterial Glycerol Stock
tetraspanin 9
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000238799    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006675.3-2202s21c1
Sequence:CCGGGTGGGTTGGGTGGCGATTATACTCGAGTATAATCGCCACCCAACCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000234797    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_006675.3-428s21c1
Sequence:CCGGTCCTAGCAGAGCTGATCTTACCTCGAGGTAAGATCAGCTCTGCTAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000234799    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 2 Clone ID:NM_006675.3-834s21c1
Sequence:CCGGCATCCACCGGACTGGTAAGAACTCGAGTTCTTACCAGTCCGGTGGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000234798    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 2 Clone ID:NM_006675.3-731s21c1
Sequence:CCGGAGATGTGGTTCGATGACAATACTCGAGTATTGTCATCGAACCACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000234796    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006675.3-318s21c1
Sequence:CCGGCATTGCCATAGGCACCATTGTCTCGAGACAATGGTGCCTATGGCAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000119247    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.55 Cell Line: A3
TRC Version: 1 Clone ID:NM_006675.3-1929s1c1
Sequence:CCGGCCCAGTTATTTCACAGACATTCTCGAGAATGTCTGTGAAATAACTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000119249    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_006675.3-177s1c1
Sequence:CCGGGTACATGATGTTCCTCTTCAACTCGAGTTGAAGAGGAACATCATGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000119248    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_006675.3-438s1c1
Sequence:CCGGGCTGATCTTACTCATCCTCTTCTCGAGAAGAGGATGAGTAAGATCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000119250    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1 Clone ID:NM_006675.3-597s1c1
Sequence:CCGGCACTGACTACACAGACTGGTACTCGAGTACCAGTCTGTGTAGTCAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000119251    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_006675.3-729s1c1
Sequence:CCGGGAAGATGTGGTTCGATGACAACTCGAGTTGTCATCGAACCACATCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006675
VALIDATED
TSPAN9 MISSION shRNA shRNA Plasmid DNA
tetraspanin 9
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000238799    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006675.3-2202s21c1
Sequence:CCGGGTGGGTTGGGTGGCGATTATACTCGAGTATAATCGCCACCCAACCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000234797    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_006675.3-428s21c1
Sequence:CCGGTCCTAGCAGAGCTGATCTTACCTCGAGGTAAGATCAGCTCTGCTAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000234799    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 2 Clone ID:NM_006675.3-834s21c1
Sequence:CCGGCATCCACCGGACTGGTAAGAACTCGAGTTCTTACCAGTCCGGTGGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000234798    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 2 Clone ID:NM_006675.3-731s21c1
Sequence:CCGGAGATGTGGTTCGATGACAATACTCGAGTATTGTCATCGAACCACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000234796    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006675.3-318s21c1
Sequence:CCGGCATTGCCATAGGCACCATTGTCTCGAGACAATGGTGCCTATGGCAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000119247    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.55 Cell Line: A3
TRC Version: 1 Clone ID:NM_006675.3-1929s1c1
Sequence:CCGGCCCAGTTATTTCACAGACATTCTCGAGAATGTCTGTGAAATAACTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000119249    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_006675.3-177s1c1
Sequence:CCGGGTACATGATGTTCCTCTTCAACTCGAGTTGAAGAGGAACATCATGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000119248    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_006675.3-438s1c1
Sequence:CCGGGCTGATCTTACTCATCCTCTTCTCGAGAAGAGGATGAGTAAGATCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000119250    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1 Clone ID:NM_006675.3-597s1c1
Sequence:CCGGCACTGACTACACAGACTGGTACTCGAGTACCAGTCTGTGTAGTCAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000119251    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_006675.3-729s1c1
Sequence:CCGGGAAGATGTGGTTCGATGACAACTCGAGTTGTCATCGAACCACATCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006675
VALIDATED
TSPAN9 MISSION shRNA Lentiviral Transduction Particles
tetraspanin 9
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000238799    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006675.3-2202s21c1
Sequence:CCGGGTGGGTTGGGTGGCGATTATACTCGAGTATAATCGCCACCCAACCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000234797    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_006675.3-428s21c1
Sequence:CCGGTCCTAGCAGAGCTGATCTTACCTCGAGGTAAGATCAGCTCTGCTAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000234799    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 2 Clone ID:NM_006675.3-834s21c1
Sequence:CCGGCATCCACCGGACTGGTAAGAACTCGAGTTCTTACCAGTCCGGTGGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000234798    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 2 Clone ID:NM_006675.3-731s21c1
Sequence:CCGGAGATGTGGTTCGATGACAATACTCGAGTATTGTCATCGAACCACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000234796    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006675.3-318s21c1
Sequence:CCGGCATTGCCATAGGCACCATTGTCTCGAGACAATGGTGCCTATGGCAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000119247    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.55 Cell Line: A3
TRC Version: 1 Clone ID:NM_006675.3-1929s1c1
Sequence:CCGGCCCAGTTATTTCACAGACATTCTCGAGAATGTCTGTGAAATAACTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000119249    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_006675.3-177s1c1
Sequence:CCGGGTACATGATGTTCCTCTTCAACTCGAGTTGAAGAGGAACATCATGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000119248    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_006675.3-438s1c1
Sequence:CCGGGCTGATCTTACTCATCCTCTTCTCGAGAAGAGGATGAGTAAGATCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000119250    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1 Clone ID:NM_006675.3-597s1c1
Sequence:CCGGCACTGACTACACAGACTGGTACTCGAGTACCAGTCTGTGTAGTCAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000119251    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_006675.3-729s1c1
Sequence:CCGGGAAGATGTGGTTCGATGACAACTCGAGTTGTCATCGAACCACATCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks