EMAIL THIS PAGE TO A FRIEND

TSPEAR

thrombospondin-type laminin G domain and EAR repeats

Synonyms: C21orf29 DFNB98 TSP-EAR
UniProtKB ID: Q8WU66
Gene ID:
Human(54084) Summary: This gene encodes a protein that contains a N-terminal thrombospondin-type laminin G domain and several tandem arranged epilepsy-associated repeats (EARs). A mutation in this gene is the cause of autosomal recessive deafness-98. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Dec 2012]
Mouse(252974) thrombospondin type laminin G domain and EAR repeats
Rat(365546) thrombospondin-type laminin G domain and EAR repeats
domestic guinea pig(100728205) thrombospondin-type laminin G domain and EAR repeats
naked mole-rat(101719563) thrombospondin-type laminin G domain and EAR repeats
cow(100335468) thrombospondin-type laminin G domain and EAR repeats
sheep(101103696) thrombospondin-type laminin G domain and EAR repeats
Zebrafish(555223) thrombospondin-type laminin G domain and EAR repeats
chicken(424836) thrombospondin-type laminin G domain and EAR repeats
Horse(100056737) thrombospondin-type laminin G domain and EAR repeats
dog(611461) thrombospondin-type laminin G domain and EAR repeats
52 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_145855 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_145855 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_145855 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_144991 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_144991 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_144991 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EMU051561 MISSION® esiRNA esiRNA targeting mouse C330046G03Rik (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_144991 Rosetta Predictions human pricing
XM_001079415 Rosetta Predictions rat pricing
XM_345089 Rosetta Predictions rat pricing
NM_145855 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_144991 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00364812 predicted 974
2 SASI_Hs01_00095178 predicted 944
3 SASI_Hs01_00095179 predicted 1135
4 SASI_Hs01_00095180 predicted 1279
5 SASI_Hs01_00095181 predicted 689
6 SASI_Hs01_00095182 predicted 1723
7 SASI_Hs01_00095183 predicted 1706
8 SASI_Hs01_00095184 predicted 1192
9 SASI_Hs01_00095185 predicted 1048
10 SASI_Hs01_00095186 predicted 327
11 SASI_Hs01_00095187 predicted 1196
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001079415 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00364320 predicted 1627
2 SASI_Rn02_00364321 predicted 1000
3 SASI_Rn02_00364322 predicted 743
4 SASI_Rn02_00364323 predicted 1003
5 SASI_Rn02_00364324 predicted 1343
6 SASI_Rn02_00364325 predicted 1341
7 SASI_Rn02_00364326 predicted 1085
8 SASI_Rn02_00364327 predicted 579
9 SASI_Rn02_00364328 predicted 1069
10 SASI_Rn02_00364329 predicted 1342
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_345089 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00397967 predicted 387
2 SASI_Rn02_00397968 predicted 869
3 SASI_Rn02_00397969 predicted 238
4 SASI_Rn02_00397970 predicted 586
5 SASI_Rn02_00397971 predicted 313
6 SASI_Rn02_00397972 predicted 358
7 SASI_Rn02_00397973 predicted 311
8 SASI_Rn02_00397974 predicted 835
9 SASI_Rn02_00397975 predicted 621
10 SASI_Rn02_00397976 predicted 443
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145855 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00026787 predicted 459
2 SASI_Mm01_00026788 predicted 1036
3 SASI_Mm01_00026789 predicted 698
4 SASI_Mm01_00026790 predicted 673
5 SASI_Mm01_00026791 predicted 557
6 SASI_Mm01_00026792 predicted 1049
7 SASI_Mm01_00026793 predicted 1204
8 SASI_Mm01_00026794 predicted 993
9 SASI_Mm01_00026795 predicted 538
10 SASI_Mm01_00026796 predicted 802
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_145855
TSPEAR MISSION shRNA Bacterial Glycerol Stock
thrombospondin-type laminin G domain and EAR repeats
Mouse
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000202401    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145855.1-1043s1c1
Sequence:CCGGGCGACATTTCACCATTGGGAACTCGAGTTCCCAATGGTGAAATGTCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000201964    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145855.1-1466s1c1
Sequence:CCGGCTTCCAGTCGTTCCTGACATTCTCGAGAATGTCAGGAACGACTGGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000200684    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145855.1-678s1c1
Sequence:CCGGGATGATAATGAGGTGCTAAATCTCGAGATTTAGCACCTCATTATCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000189903    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145855.1-1542s1c1
Sequence:CCGGGCAAACAGTCACAGCTACGATCTCGAGATCGTAGCTGTGACTGTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000190321    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145855.1-702s1c1
Sequence:CCGGCCCTATGAAGCTGACATGAAACTCGAGTTTCATGTCAGCTTCATAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000192739    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145855.1-972s1c1
Sequence:CCGGGCCATCTATAAATGGACAGATCTCGAGATCTGTCCATTTATAGATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_145855
TSPEAR MISSION shRNA shRNA Plasmid DNA
thrombospondin-type laminin G domain and EAR repeats
Mouse
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000202401    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145855.1-1043s1c1
Sequence:CCGGGCGACATTTCACCATTGGGAACTCGAGTTCCCAATGGTGAAATGTCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000201964    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145855.1-1466s1c1
Sequence:CCGGCTTCCAGTCGTTCCTGACATTCTCGAGAATGTCAGGAACGACTGGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000200684    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145855.1-678s1c1
Sequence:CCGGGATGATAATGAGGTGCTAAATCTCGAGATTTAGCACCTCATTATCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000189903    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145855.1-1542s1c1
Sequence:CCGGGCAAACAGTCACAGCTACGATCTCGAGATCGTAGCTGTGACTGTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000190321    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145855.1-702s1c1
Sequence:CCGGCCCTATGAAGCTGACATGAAACTCGAGTTTCATGTCAGCTTCATAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000192739    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145855.1-972s1c1
Sequence:CCGGGCCATCTATAAATGGACAGATCTCGAGATCTGTCCATTTATAGATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_145855
TSPEAR MISSION shRNA Lentiviral Transduction Particles
thrombospondin-type laminin G domain and EAR repeats
Mouse
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000202401    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145855.1-1043s1c1
Sequence:CCGGGCGACATTTCACCATTGGGAACTCGAGTTCCCAATGGTGAAATGTCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000201964    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145855.1-1466s1c1
Sequence:CCGGCTTCCAGTCGTTCCTGACATTCTCGAGAATGTCAGGAACGACTGGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000200684    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145855.1-678s1c1
Sequence:CCGGGATGATAATGAGGTGCTAAATCTCGAGATTTAGCACCTCATTATCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000189903    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145855.1-1542s1c1
Sequence:CCGGGCAAACAGTCACAGCTACGATCTCGAGATCGTAGCTGTGACTGTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000190321    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145855.1-702s1c1
Sequence:CCGGCCCTATGAAGCTGACATGAAACTCGAGTTTCATGTCAGCTTCATAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000192739    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145855.1-972s1c1
Sequence:CCGGGCCATCTATAAATGGACAGATCTCGAGATCTGTCCATTTATAGATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_144991
TSPEAR MISSION shRNA Bacterial Glycerol Stock
thrombospondin-type laminin G domain and EAR repeats
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000158067    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144991.2-945s1c1
Sequence:CCGGCCTGTATCTGTGTGTTGGCAACTCGAGTTGCCAACACACAGATACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000156520    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144991.2-1017s1c1
Sequence:CCGGGCATCAGAACTTGTCCACCAACTCGAGTTGGTGGACAAGTTCTGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000156291    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144991.2-823s1c1
Sequence:CCGGCCAGAAGATAACGAGGTGCTACTCGAGTAGCACCTCGTTATCTTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000151120    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144991.2-1138s1c1
Sequence:CCGGGAAGAGAAGTTCGTCTCATATCTCGAGATATGAGACGAACTTCTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000152754    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144991.2-1286s1c1
Sequence:CCGGGCCACAGAAAGCTGAAGTTTACTCGAGTAAACTTCAGCTTTCTGTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000153910    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144991.2-1137s1c1
Sequence:CCGGCGAAGAGAAGTTCGTCTCATACTCGAGTATGAGACGAACTTCTCTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000153392    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_144991.2-3559s1c1
Sequence:CCGGGCACCTGTGAAAGGAAGATTACTCGAGTAATCTTCCTTTCACAGGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000154189    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144991.2-336s1c1
Sequence:CCGGCGTAACTTTGAGAGTTCCCAACTCGAGTTGGGAACTCTCAAAGTTACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000437831    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_144991.2-2490s21c1
Sequence:CCGGGCCATTGCCGCCACCTATTTACTCGAGTAAATAGGTGGCGGCAATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000420417    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_144991.2-2520s21c1
Sequence:CCGGATCTGAACGGAAGTGTATTTACTCGAGTAAATACACTTCCGTTCAGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_144991
TSPEAR MISSION shRNA shRNA Plasmid DNA
thrombospondin-type laminin G domain and EAR repeats
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000158067    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144991.2-945s1c1
Sequence:CCGGCCTGTATCTGTGTGTTGGCAACTCGAGTTGCCAACACACAGATACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000156520    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144991.2-1017s1c1
Sequence:CCGGGCATCAGAACTTGTCCACCAACTCGAGTTGGTGGACAAGTTCTGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000156291    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144991.2-823s1c1
Sequence:CCGGCCAGAAGATAACGAGGTGCTACTCGAGTAGCACCTCGTTATCTTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000151120    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144991.2-1138s1c1
Sequence:CCGGGAAGAGAAGTTCGTCTCATATCTCGAGATATGAGACGAACTTCTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000152754    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144991.2-1286s1c1
Sequence:CCGGGCCACAGAAAGCTGAAGTTTACTCGAGTAAACTTCAGCTTTCTGTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000153910    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144991.2-1137s1c1
Sequence:CCGGCGAAGAGAAGTTCGTCTCATACTCGAGTATGAGACGAACTTCTCTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000153392    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_144991.2-3559s1c1
Sequence:CCGGGCACCTGTGAAAGGAAGATTACTCGAGTAATCTTCCTTTCACAGGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000154189    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144991.2-336s1c1
Sequence:CCGGCGTAACTTTGAGAGTTCCCAACTCGAGTTGGGAACTCTCAAAGTTACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000437831    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_144991.2-2490s21c1
Sequence:CCGGGCCATTGCCGCCACCTATTTACTCGAGTAAATAGGTGGCGGCAATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000420417    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_144991.2-2520s21c1
Sequence:CCGGATCTGAACGGAAGTGTATTTACTCGAGTAAATACACTTCCGTTCAGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_144991
TSPEAR MISSION shRNA Lentiviral Transduction Particles
thrombospondin-type laminin G domain and EAR repeats
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000158067    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144991.2-945s1c1
Sequence:CCGGCCTGTATCTGTGTGTTGGCAACTCGAGTTGCCAACACACAGATACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000156520    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144991.2-1017s1c1
Sequence:CCGGGCATCAGAACTTGTCCACCAACTCGAGTTGGTGGACAAGTTCTGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000156291    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144991.2-823s1c1
Sequence:CCGGCCAGAAGATAACGAGGTGCTACTCGAGTAGCACCTCGTTATCTTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000151120    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144991.2-1138s1c1
Sequence:CCGGGAAGAGAAGTTCGTCTCATATCTCGAGATATGAGACGAACTTCTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000152754    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144991.2-1286s1c1
Sequence:CCGGGCCACAGAAAGCTGAAGTTTACTCGAGTAAACTTCAGCTTTCTGTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000153910    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144991.2-1137s1c1
Sequence:CCGGCGAAGAGAAGTTCGTCTCATACTCGAGTATGAGACGAACTTCTCTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000153392    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_144991.2-3559s1c1
Sequence:CCGGGCACCTGTGAAAGGAAGATTACTCGAGTAATCTTCCTTTCACAGGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000154189    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144991.2-336s1c1
Sequence:CCGGCGTAACTTTGAGAGTTCCCAACTCGAGTTGGGAACTCTCAAAGTTACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000437831    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_144991.2-2490s21c1
Sequence:CCGGGCCATTGCCGCCACCTATTTACTCGAGTAAATAGGTGGCGGCAATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000420417    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_144991.2-2520s21c1
Sequence:CCGGATCTGAACGGAAGTGTATTTACTCGAGTAAATACACTTCCGTTCAGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks