EMAIL THIS PAGE TO A FRIEND

TSPO2

translocator protein 2

Synonyms: BZRPL1
UniProtKB ID: Q5TGU0, B2RPR2, B7ZMN8, Q3SX82
Gene ID:
Mouse(70026) translocator protein 2
Rat(682829) translocator protein 2
domestic guinea pig(100721262) translocator protein 2
naked mole-rat(101722174) translocator protein 2
cow(100295327) translocator protein 2
sheep(101107742) translocator protein 2
chicken(419914) translocator protein 2
domestic cat(101097644) translocator protein 2
dog(481787) translocator protein 2
45 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_027292 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_027292 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_027292 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-XM_167072 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-XM_167072 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-XM_167072 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001010873 Rosetta Predictions human pricing
XM_001063305 Rosetta Predictions rat pricing
NM_027292 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001010873 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00027996 predicted 511
2 SASI_Hs01_00027997 predicted 690
3 SASI_Hs01_00027998 predicted 605
4 SASI_Hs01_00027999 predicted 517
5 SASI_Hs01_00028001 predicted 602
6 SASI_Hs01_00028002 predicted 628
7 SASI_Hs01_00028003 predicted 373
8 SASI_Hs02_00305829 predicted 301
9 SASI_Hs01_00028004 predicted 377
10 SASI_Hs01_00028005 predicted 710
11 SASI_Hs01_00028000 predicted 484
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001063305 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00306620 predicted 452
2 SASI_Rn02_00306621 predicted 357
3 SASI_Rn02_00306622 predicted 305
4 SASI_Rn02_00306623 predicted 254
5 SASI_Rn02_00306624 predicted 342
6 SASI_Rn02_00306625 predicted 339
7 SASI_Rn02_00306626 predicted 259
8 SASI_Rn02_00306627 predicted 231
9 SASI_Rn02_00306628 predicted 257
10 SASI_Rn02_00306629 predicted 317
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_027292 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00075231 predicted 378
2 SASI_Mm01_00075232 predicted 431
3 SASI_Mm01_00075233 predicted 596
4 SASI_Mm02_00331896 predicted 304
5 SASI_Mm01_00075234 predicted 596
6 SASI_Mm01_00075236 predicted 372
7 SASI_Mm01_00075237 predicted 404
8 SASI_Mm01_00075238 predicted 604
9 SASI_Mm01_00075239 predicted 421
10 SASI_Mm02_00331897 predicted 302
11 SASI_Mm01_00075235 predicted 641
12 SASI_Mm01_00075240 predicted 591
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_027292
TSPO2 MISSION shRNA Bacterial Glycerol Stock
translocator protein 2
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000102056    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027292.1-577s1c1
Sequence:CCGGCTGGACCTCTTACTGCTCTATCTCGAGATAGAGCAGTAAGAGGTCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000102057    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027292.1-317s1c1
Sequence:CCGGGTATGCTCATTCATCAGCCATCTCGAGATGGCTGATGAATGAGCATACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000102055    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027292.1-375s1c1
Sequence:CCGGCCCACCTCACAAGGTCATATTCTCGAGAATATGACCTTGTGAGGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000102059    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027292.1-379s1c1
Sequence:CCGGCCTCACAAGGTCATATTGCTTCTCGAGAAGCAATATGACCTTGTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000102058    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027292.1-345s1c1
Sequence:CCGGGTGTGAGGATGAGAGAAAGTTCTCGAGAACTTTCTCTCATCCTCACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_027292
TSPO2 MISSION shRNA shRNA Plasmid DNA
translocator protein 2
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000102056    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027292.1-577s1c1
Sequence:CCGGCTGGACCTCTTACTGCTCTATCTCGAGATAGAGCAGTAAGAGGTCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000102057    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027292.1-317s1c1
Sequence:CCGGGTATGCTCATTCATCAGCCATCTCGAGATGGCTGATGAATGAGCATACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000102055    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027292.1-375s1c1
Sequence:CCGGCCCACCTCACAAGGTCATATTCTCGAGAATATGACCTTGTGAGGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000102059    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027292.1-379s1c1
Sequence:CCGGCCTCACAAGGTCATATTGCTTCTCGAGAAGCAATATGACCTTGTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000102058    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027292.1-345s1c1
Sequence:CCGGGTGTGAGGATGAGAGAAAGTTCTCGAGAACTTTCTCTCATCCTCACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_027292
TSPO2 MISSION shRNA Lentiviral Transduction Particles
translocator protein 2
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000102056    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027292.1-577s1c1
Sequence:CCGGCTGGACCTCTTACTGCTCTATCTCGAGATAGAGCAGTAAGAGGTCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000102057    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027292.1-317s1c1
Sequence:CCGGGTATGCTCATTCATCAGCCATCTCGAGATGGCTGATGAATGAGCATACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000102055    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027292.1-375s1c1
Sequence:CCGGCCCACCTCACAAGGTCATATTCTCGAGAATATGACCTTGTGAGGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000102059    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027292.1-379s1c1
Sequence:CCGGCCTCACAAGGTCATATTGCTTCTCGAGAAGCAATATGACCTTGTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000102058    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027292.1-345s1c1
Sequence:CCGGGTGTGAGGATGAGAGAAAGTTCTCGAGAACTTTCTCTCATCCTCACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_167072
TSPO2 MISSION shRNA Bacterial Glycerol Stock
translocator protein 2
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000060788    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_167072.3-422s1c1
Sequence:CCGGCCCATTCTACAAAGTCTTATTCTCGAGAATAAGACTTTGTAGAATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000060790    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_167072.3-362s1c1
Sequence:CCGGGCTGTTCACTCGTGATCACATCTCGAGATGTGATCACGAGTGAACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000060792    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_167072.3-675s1c1
Sequence:CCGGCATCCCATCAACAAACTGGCTCTCGAGAGCCAGTTTGTTGATGGGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000060791    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_167072.3-573s1c1
Sequence:CCGGTGGACTGTCCTGGTTCTCTTTCTCGAGAAAGAGAACCAGGACAGTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000060789    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_167072.3-443s1c1
Sequence:CCGGGCTTGTACAGACAGCCATCTACTCGAGTAGATGGCTGTCTGTACAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_167072
TSPO2 MISSION shRNA shRNA Plasmid DNA
translocator protein 2
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000060788    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_167072.3-422s1c1
Sequence:CCGGCCCATTCTACAAAGTCTTATTCTCGAGAATAAGACTTTGTAGAATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000060790    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_167072.3-362s1c1
Sequence:CCGGGCTGTTCACTCGTGATCACATCTCGAGATGTGATCACGAGTGAACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000060792    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_167072.3-675s1c1
Sequence:CCGGCATCCCATCAACAAACTGGCTCTCGAGAGCCAGTTTGTTGATGGGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000060791    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_167072.3-573s1c1
Sequence:CCGGTGGACTGTCCTGGTTCTCTTTCTCGAGAAAGAGAACCAGGACAGTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000060789    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_167072.3-443s1c1
Sequence:CCGGGCTTGTACAGACAGCCATCTACTCGAGTAGATGGCTGTCTGTACAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_167072
TSPO2 MISSION shRNA Lentiviral Transduction Particles
translocator protein 2
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000060788    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_167072.3-422s1c1
Sequence:CCGGCCCATTCTACAAAGTCTTATTCTCGAGAATAAGACTTTGTAGAATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000060790    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_167072.3-362s1c1
Sequence:CCGGGCTGTTCACTCGTGATCACATCTCGAGATGTGATCACGAGTGAACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000060792    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_167072.3-675s1c1
Sequence:CCGGCATCCCATCAACAAACTGGCTCTCGAGAGCCAGTTTGTTGATGGGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000060791    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_167072.3-573s1c1
Sequence:CCGGTGGACTGTCCTGGTTCTCTTTCTCGAGAAAGAGAACCAGGACAGTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000060789    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_167072.3-443s1c1
Sequence:CCGGGCTTGTACAGACAGCCATCTACTCGAGTAGATGGCTGTCTGTACAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks