EMAIL THIS PAGE TO A FRIEND

TSPO

translocator protein (18kDa)

Synonyms: BPBS BZRP DBI IBP MBR PBR PBS PKBS PTBR mDRC pk18
UniProtKB ID: P30536, Q53Y59, Q6ICF9, Q96TF6
Gene ID:
Human(706) Summary: Present mainly in the mitochondrial compartment of peripheral tissues, the protein encoded by this gene interacts with some benzodiazepines and has different affinities than its endogenous counterpart. The protein is a key factor in the flow of cholesterol into mitochondria to permit the initiation of steroid hormone synthesis. Alternatively spliced transcript variants have been reported; one of the variants lacks an internal exon and is considered non-coding, and the other variants encode the same protein. [provided by RefSeq, Feb 2012]
Mouse(12257) translocator protein
Rat(24230) translocator protein
Thale Cress(819389) tryptophan-rich sensory protein-like protein
Zebrafish(450011) translocator protein
chicken(418226) translocator protein (18kDa)
domestic cat(101087076) translocator protein (18kDa)
dog(474475) translocator protein (18kDa)
cow(281033) translocator protein (18kDa)
naked mole-rat(101713080) translocator protein (18kDa)
domestic guinea pig(100722263) translocator protein (18kDa)
73 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Proteins

Product # Description Species Add to Cart
 
B4938 Benzodiazepine Receptor, Peripheral human membrane suspension human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_000714 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000714 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000714 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_009775 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009775 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009775 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU080541 MISSION® esiRNA esiRNA human TSPO (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000714 Rosetta Predictions human pricing
NM_007311 Rosetta Predictions human pricing
NM_012515 Rosetta Predictions rat pricing
NM_009775 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000714 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00054085 predicted 536
2 SASI_Hs01_00054086 predicted 533
3 SASI_Hs01_00054087 predicted 557
4 SASI_Hs01_00054088 predicted 637
5 SASI_Hs01_00054089 predicted 559
6 SASI_Hs01_00054090 predicted 544
7 SASI_Hs01_00054091 predicted 589
8 SASI_Hs01_00054093 predicted 617
9 SASI_Hs01_00054094 predicted 556
10 SASI_Hs02_00303125 predicted 548
11 SASI_Hs01_00054092 predicted 534
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007311 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00198299 predicted 324
2 SASI_Hs01_00198300 predicted 318
3 SASI_Hs01_00198301 predicted 342
4 SASI_Hs01_00198302 predicted 428
5 SASI_Hs01_00198303 predicted 343
6 SASI_Hs01_00198304 predicted 333
7 SASI_Hs01_00198305 predicted 383
8 SASI_Hs01_00198307 predicted 405
9 SASI_Hs01_00198308 predicted 351
10 SASI_Hs02_00343381 predicted 329
11 SASI_Hs01_00198306 predicted 313
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012515 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00259577 predicted 268
2 SASI_Rn01_00062663 predicted 545
3 SASI_Rn01_00062664 predicted 266
4 SASI_Rn01_00062665 predicted 483
5 SASI_Rn01_00062666 predicted 215
6 SASI_Rn01_00062667 predicted 257
7 SASI_Rn01_00062668 predicted 484
8 SASI_Rn01_00062669 predicted 228
9 SASI_Rn01_00062670 predicted 228
10 SASI_Rn01_00062671 predicted 260
11 SASI_Rn01_00062662 predicted 477
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009775 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00316996 predicted 335
2 SASI_Mm01_00030361 predicted 422
3 SASI_Mm02_00316997 predicted 325
4 SASI_Mm02_00316998 predicted 256
5 SASI_Mm01_00030363 predicted 545
6 SASI_Mm01_00030365 predicted 324
7 SASI_Mm01_00030366 predicted 283
8 SASI_Mm01_00030367 predicted 289
9 SASI_Mm01_00030368 predicted 301
10 SASI_Mm02_00316999 predicted 310
11 SASI_Mm01_00030359 predicted 633
12 SASI_Mm01_00030360 predicted 629
13 SASI_Mm01_00030362 predicted 217
14 SASI_Mm01_00030364 predicted 224
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000714
VALIDATED
TSPO MISSION shRNA Bacterial Glycerol Stock
translocator protein (18kDa)
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000331333    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_000714.4-321s21c1
Sequence:CCGGAGGCTTCACAGAGAAGGCTGTCTCGAGACAGCCTTCTCTGTGAAGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000331334    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_000714.4-680s21c1
Sequence:CCGGCGTCACGCTTTCATGACCACTCTCGAGAGTGGTCATGAAAGCGTGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000299912    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000714.4-399s21c1
Sequence:CCGGCTTCTTTGGTGCCCGACAAATCTCGAGATTTGTCGGGCACCAAAGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000299911    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_000714.4-548s21c1
Sequence:CCGGCCACACTCAACTACTGCGTATCTCGAGATACGCAGTAGTTGAGTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000299975    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_000714.4-291s21c1
Sequence:CCGGCGGCTCCTACCTGGTCTGGAACTCGAGTTCCAGACCAGGTAGGAGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000060433    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_000714.3-530s1c1
Sequence:CCGGCCACACTCAACTACTGCGTATCTCGAGATACGCAGTAGTTGAGTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000060434    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_000714.3-381s1c1
Sequence:CCGGCTTCTTTGGTGCCCGACAAATCTCGAGATTTGTCGGGCACCAAAGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000060437    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000714.3-392s1c1
Sequence:CCGGCCCGACAAATGGGCTGGGCCTCTCGAGAGGCCCAGCCCATTTGTCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000060435    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_000714.3-273s1c1
Sequence:CCGGCGGCTCCTACCTGGTCTGGAACTCGAGTTCCAGACCAGGTAGGAGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000714
VALIDATED
TSPO MISSION shRNA shRNA Plasmid DNA
translocator protein (18kDa)
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000331333    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_000714.4-321s21c1
Sequence:CCGGAGGCTTCACAGAGAAGGCTGTCTCGAGACAGCCTTCTCTGTGAAGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000331334    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_000714.4-680s21c1
Sequence:CCGGCGTCACGCTTTCATGACCACTCTCGAGAGTGGTCATGAAAGCGTGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000299912    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000714.4-399s21c1
Sequence:CCGGCTTCTTTGGTGCCCGACAAATCTCGAGATTTGTCGGGCACCAAAGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000299911    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_000714.4-548s21c1
Sequence:CCGGCCACACTCAACTACTGCGTATCTCGAGATACGCAGTAGTTGAGTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000299975    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_000714.4-291s21c1
Sequence:CCGGCGGCTCCTACCTGGTCTGGAACTCGAGTTCCAGACCAGGTAGGAGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000060433    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_000714.3-530s1c1
Sequence:CCGGCCACACTCAACTACTGCGTATCTCGAGATACGCAGTAGTTGAGTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000060434    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_000714.3-381s1c1
Sequence:CCGGCTTCTTTGGTGCCCGACAAATCTCGAGATTTGTCGGGCACCAAAGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000060437    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000714.3-392s1c1
Sequence:CCGGCCCGACAAATGGGCTGGGCCTCTCGAGAGGCCCAGCCCATTTGTCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000060435    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_000714.3-273s1c1
Sequence:CCGGCGGCTCCTACCTGGTCTGGAACTCGAGTTCCAGACCAGGTAGGAGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000714
VALIDATED
TSPO MISSION shRNA Lentiviral Transduction Particles
translocator protein (18kDa)
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000331333    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_000714.4-321s21c1
Sequence:CCGGAGGCTTCACAGAGAAGGCTGTCTCGAGACAGCCTTCTCTGTGAAGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000331334    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_000714.4-680s21c1
Sequence:CCGGCGTCACGCTTTCATGACCACTCTCGAGAGTGGTCATGAAAGCGTGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000299912    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000714.4-399s21c1
Sequence:CCGGCTTCTTTGGTGCCCGACAAATCTCGAGATTTGTCGGGCACCAAAGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000299911    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_000714.4-548s21c1
Sequence:CCGGCCACACTCAACTACTGCGTATCTCGAGATACGCAGTAGTTGAGTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000299975    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_000714.4-291s21c1
Sequence:CCGGCGGCTCCTACCTGGTCTGGAACTCGAGTTCCAGACCAGGTAGGAGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000060433    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_000714.3-530s1c1
Sequence:CCGGCCACACTCAACTACTGCGTATCTCGAGATACGCAGTAGTTGAGTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000060434    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_000714.3-381s1c1
Sequence:CCGGCTTCTTTGGTGCCCGACAAATCTCGAGATTTGTCGGGCACCAAAGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000060437    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000714.3-392s1c1
Sequence:CCGGCCCGACAAATGGGCTGGGCCTCTCGAGAGGCCCAGCCCATTTGTCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000060435    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_000714.3-273s1c1
Sequence:CCGGCGGCTCCTACCTGGTCTGGAACTCGAGTTCCAGACCAGGTAGGAGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009775
VALIDATED
TSPO MISSION shRNA Bacterial Glycerol Stock
translocator protein (18kDa)
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000102105    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009775.2-630s1c1
Sequence:CCGGCCATCATGCTTTCATGACCATCTCGAGATGGTCATGAAAGCATGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000102107    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009775.2-517s1c1
Sequence:CCGGACTACTATGTATGGCGTGATACTCGAGTATCACGCCATACATAGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000102109    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009775.2-161s1c1
Sequence:CCGGGTGGTATGCTAGCTTGCAGAACTCGAGTTCTGCAAGCTAGCATACCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000102108    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009775.2-251s1c1
Sequence:CCGGTGGCTCCTACATAGTCTGGAACTCGAGTTCCAGACTATGTAGGAGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000102106    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009775.2-508s1c1
Sequence:CCGGCCGTGCTCAACTACTATGTATCTCGAGATACATAGTAGTTGAGCACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009775
VALIDATED
TSPO MISSION shRNA shRNA Plasmid DNA
translocator protein (18kDa)
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000102105    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009775.2-630s1c1
Sequence:CCGGCCATCATGCTTTCATGACCATCTCGAGATGGTCATGAAAGCATGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000102107    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009775.2-517s1c1
Sequence:CCGGACTACTATGTATGGCGTGATACTCGAGTATCACGCCATACATAGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000102109    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009775.2-161s1c1
Sequence:CCGGGTGGTATGCTAGCTTGCAGAACTCGAGTTCTGCAAGCTAGCATACCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000102108    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009775.2-251s1c1
Sequence:CCGGTGGCTCCTACATAGTCTGGAACTCGAGTTCCAGACTATGTAGGAGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000102106    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009775.2-508s1c1
Sequence:CCGGCCGTGCTCAACTACTATGTATCTCGAGATACATAGTAGTTGAGCACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009775
VALIDATED
TSPO MISSION shRNA Lentiviral Transduction Particles
translocator protein (18kDa)
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000102105    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009775.2-630s1c1
Sequence:CCGGCCATCATGCTTTCATGACCATCTCGAGATGGTCATGAAAGCATGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000102107    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009775.2-517s1c1
Sequence:CCGGACTACTATGTATGGCGTGATACTCGAGTATCACGCCATACATAGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000102109    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009775.2-161s1c1
Sequence:CCGGGTGGTATGCTAGCTTGCAGAACTCGAGTTCTGCAAGCTAGCATACCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000102108    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009775.2-251s1c1
Sequence:CCGGTGGCTCCTACATAGTCTGGAACTCGAGTTCCAGACTATGTAGGAGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000102106    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009775.2-508s1c1
Sequence:CCGGCCGTGCTCAACTACTATGTATCTCGAGATACATAGTAGTTGAGCACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks