EMAIL THIS PAGE TO A FRIEND

TSPY1

testis specific protein, Y-linked 1

Synonyms: CT78 DYS14 TSPY pJA923
UniProtKB ID: Q01534, A6NJD2, O00216, P09002, Q0VAD3, Q9UNN7
Gene ID:
Human(7258) Summary: The protein encoded by this gene is found only in testicular tissue and may be involved in spermatogenesis. Approximately 35 copies of this gene are present in humans, but only a single, nonfunctional orthologous gene is found in mouse. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2010]
Rat(25223) testis specific protein, Y-linked 1
42 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_003308 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003308 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003308 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003308 Rosetta Predictions human pricing
NM_022923 Rosetta Predictions rat pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003308 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00335414 predicted 553
2 SASI_Hs02_00335415 predicted 778
3 SASI_Hs01_00040036 predicted 845
4 SASI_Hs02_00335416 predicted 545
5 SASI_Hs02_00335417 predicted 507
6 SASI_Hs01_00040041 predicted 830
7 SASI_Hs02_00335418 predicted 641
8 SASI_Hs02_00335419 predicted 849
9 SASI_Hs02_00335420 predicted 675
10 SASI_Hs02_00335421 predicted 700
11 SASI_Hs01_00040035 predicted 406
12 SASI_Hs01_00040037 predicted 840
13 SASI_Hs01_00040038 predicted 407
14 SASI_Hs01_00040039 predicted 848
15 SASI_Hs01_00040040 predicted 855
16 SASI_Hs01_00040042 predicted 837
17 SASI_Hs01_00040043 predicted 837
18 SASI_Hs01_00040044 predicted 858
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022923 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00087722 predicted 240
2 SASI_Rn02_00263612 predicted 526
3 SASI_Rn01_00087723 predicted 342
4 SASI_Rn01_00087724 predicted 649
5 SASI_Rn01_00087725 predicted 724
6 SASI_Rn02_00263613 predicted 240
7 SASI_Rn01_00087728 predicted 463
8 SASI_Rn01_00087729 predicted 482
9 SASI_Rn01_00087730 predicted 454
10 SASI_Rn02_00263614 predicted 493
11 SASI_Rn01_00087726 predicted 702
12 SASI_Rn01_00087727 predicted 392
13 SASI_Rn01_00087731 predicted 742
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003308
TSPY1 MISSION shRNA Bacterial Glycerol Stock
testis specific protein, Y-linked 1
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000143957    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003308.2-696s1c1
Sequence:CCGGCAAGGAATATCTGGTGAACATCTCGAGATGTTCACCAGATATTCCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000139810    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003308.2-795s1c1
Sequence:CCGGCCACAACAGCAGCCTTAACTTCTCGAGAAGTTAAGGCTGCTGTTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000140791    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003308.2-607s1c1
Sequence:CCGGGAGGTGGAAGAAGAGAAGCATCTCGAGATGCTTCTCTTCTTCCACCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000144787    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003308.2-858s1c1
Sequence:CCGGGATTGCTGAGATCCTATGTAACTCGAGTTACATAGGATCTCAGCAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000144101    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003308.2-648s1c1
Sequence:CCGGCATGTTGTTCTTTCGGAGTAACTCGAGTTACTCCGAAAGAACAACATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000144190    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003308.2-807s1c1
Sequence:CCGGCCTTAACTTCTTCAACTGGTTCTCGAGAACCAGTTGAAGAAGTTAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000433214    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003308.3-974s21c1
Sequence:CCGGATATGATGGAGCATCAGATTTCTCGAGAAATCTGATGCTCCATCATATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000430587    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003308.3-239s21c1
Sequence:CCGGCTGCTGTTGGATGACATAATGCTCGAGCATTATGTCATCCAACAGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000425417    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003308.3-836s21c1
Sequence:CCGGCACAACTTCGCAGGATCTAACCTCGAGGTTAGATCCTGCGAAGTTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003308
TSPY1 MISSION shRNA shRNA Plasmid DNA
testis specific protein, Y-linked 1
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000143957    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003308.2-696s1c1
Sequence:CCGGCAAGGAATATCTGGTGAACATCTCGAGATGTTCACCAGATATTCCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000139810    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003308.2-795s1c1
Sequence:CCGGCCACAACAGCAGCCTTAACTTCTCGAGAAGTTAAGGCTGCTGTTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000140791    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003308.2-607s1c1
Sequence:CCGGGAGGTGGAAGAAGAGAAGCATCTCGAGATGCTTCTCTTCTTCCACCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000144787    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003308.2-858s1c1
Sequence:CCGGGATTGCTGAGATCCTATGTAACTCGAGTTACATAGGATCTCAGCAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000144101    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003308.2-648s1c1
Sequence:CCGGCATGTTGTTCTTTCGGAGTAACTCGAGTTACTCCGAAAGAACAACATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000144190    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003308.2-807s1c1
Sequence:CCGGCCTTAACTTCTTCAACTGGTTCTCGAGAACCAGTTGAAGAAGTTAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000433214    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003308.3-974s21c1
Sequence:CCGGATATGATGGAGCATCAGATTTCTCGAGAAATCTGATGCTCCATCATATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000430587    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003308.3-239s21c1
Sequence:CCGGCTGCTGTTGGATGACATAATGCTCGAGCATTATGTCATCCAACAGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000425417    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003308.3-836s21c1
Sequence:CCGGCACAACTTCGCAGGATCTAACCTCGAGGTTAGATCCTGCGAAGTTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003308
TSPY1 MISSION shRNA Lentiviral Transduction Particles
testis specific protein, Y-linked 1
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000143957    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003308.2-696s1c1
Sequence:CCGGCAAGGAATATCTGGTGAACATCTCGAGATGTTCACCAGATATTCCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000139810    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003308.2-795s1c1
Sequence:CCGGCCACAACAGCAGCCTTAACTTCTCGAGAAGTTAAGGCTGCTGTTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000140791    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003308.2-607s1c1
Sequence:CCGGGAGGTGGAAGAAGAGAAGCATCTCGAGATGCTTCTCTTCTTCCACCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000144787    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003308.2-858s1c1
Sequence:CCGGGATTGCTGAGATCCTATGTAACTCGAGTTACATAGGATCTCAGCAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000144101    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003308.2-648s1c1
Sequence:CCGGCATGTTGTTCTTTCGGAGTAACTCGAGTTACTCCGAAAGAACAACATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000144190    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003308.2-807s1c1
Sequence:CCGGCCTTAACTTCTTCAACTGGTTCTCGAGAACCAGTTGAAGAAGTTAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000433214    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003308.3-974s21c1
Sequence:CCGGATATGATGGAGCATCAGATTTCTCGAGAAATCTGATGCTCCATCATATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000430587    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003308.3-239s21c1
Sequence:CCGGCTGCTGTTGGATGACATAATGCTCGAGCATTATGTCATCCAACAGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000425417    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003308.3-836s21c1
Sequence:CCGGCACAACTTCGCAGGATCTAACCTCGAGGTTAGATCCTGCGAAGTTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks