EMAIL THIS PAGE TO A FRIEND

TSPY2

testis specific protein, Y-linked 2

Synonyms: TSPYQ1
Species: Human TSPY2(64591)
UniProtKB ID: A6NKD2
Gene ID:
28 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1407889 Anti-TSPY2 antibody produced in mouse purified immunoglobulin, buffered aqueous solution human
western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_022573 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_022573 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_022573 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_022573 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022573 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00355868 predicted 558
2 SASI_Hs02_00355869 predicted 771
3 SASI_Hs01_00103008 predicted 841
4 SASI_Hs02_00355870 predicted 620
5 SASI_Hs01_00103013 predicted 828
6 SASI_Hs02_00355871 predicted 640
7 SASI_Hs02_00355872 predicted 852
8 SASI_Hs02_00355873 predicted 669
9 SASI_Hs02_00355874 predicted 695
10 SASI_Hs02_00355875 predicted 556
11 SASI_Hs01_00103007 predicted 409
12 SASI_Hs01_00103009 predicted 841
13 SASI_Hs01_00103010 predicted 412
14 SASI_Hs01_00103011 predicted 845
15 SASI_Hs01_00103012 predicted 862
16 SASI_Hs01_00103014 predicted 834
17 SASI_Hs01_00103015 predicted 835
18 SASI_Hs01_00103016 predicted 858
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_022573
TSPY2 MISSION shRNA Bacterial Glycerol Stock
testis specific protein, Y-linked 2
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000166736    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022573.1-838s1c1
Sequence:CCGGCCACAACTTCGCAGGATCTAACTCGAGTTAGATCCTGCGAAGTTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000159575    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022573.1-682s1c1
Sequence:CCGGCCAGAATAAAGTGATTACCAACTCGAGTTGGTAATCACTTTATTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000160191    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022573.1-811s1c1
Sequence:CCGGCCTTAACTTCTTCAACTGGTTCTCGAGAACCAGTTGAAGAAGTTAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000162708    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022573.1-563s1c1
Sequence:CCGGCTGATCACTGACGAAGATGAACTCGAGTTCATCTTCGTCAGTGATCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000166131    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022573.1-826s1c1
Sequence:CCGGCTGGTTCTCTGACCACAACTTCTCGAGAAGTTGTGGTCAGAGAACCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000161962    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022573.1-807s1c1
Sequence:CCGGGCAGCCTTAACTTCTTCAACTCTCGAGAGTTGAAGAAGTTAAGGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000161647    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022573.1-734s1c1
Sequence:CCGGGCTTCTCATTCCACTCCAATTCTCGAGAATTGGAGTGGAATGAGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000161702    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022573.1-241s1c1
Sequence:CCGGGCTGCTGTTGGATGACATAATCTCGAGATTATGTCATCCAACAGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000165893    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022573.1-628s1c1
Sequence:CCGGGCATCGTGTTCATCTCTGCAACTCGAGTTGCAGAGATGAACACGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000166226    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022573.1-799s1c1
Sequence:CCGGCCACAACAGCAGCCTTAACTTCTCGAGAAGTTAAGGCTGCTGTTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_022573
TSPY2 MISSION shRNA shRNA Plasmid DNA
testis specific protein, Y-linked 2
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000166736    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022573.1-838s1c1
Sequence:CCGGCCACAACTTCGCAGGATCTAACTCGAGTTAGATCCTGCGAAGTTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000159575    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022573.1-682s1c1
Sequence:CCGGCCAGAATAAAGTGATTACCAACTCGAGTTGGTAATCACTTTATTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000160191    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022573.1-811s1c1
Sequence:CCGGCCTTAACTTCTTCAACTGGTTCTCGAGAACCAGTTGAAGAAGTTAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000162708    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022573.1-563s1c1
Sequence:CCGGCTGATCACTGACGAAGATGAACTCGAGTTCATCTTCGTCAGTGATCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000166131    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022573.1-826s1c1
Sequence:CCGGCTGGTTCTCTGACCACAACTTCTCGAGAAGTTGTGGTCAGAGAACCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000161962    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022573.1-807s1c1
Sequence:CCGGGCAGCCTTAACTTCTTCAACTCTCGAGAGTTGAAGAAGTTAAGGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000161647    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022573.1-734s1c1
Sequence:CCGGGCTTCTCATTCCACTCCAATTCTCGAGAATTGGAGTGGAATGAGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000161702    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022573.1-241s1c1
Sequence:CCGGGCTGCTGTTGGATGACATAATCTCGAGATTATGTCATCCAACAGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000165893    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022573.1-628s1c1
Sequence:CCGGGCATCGTGTTCATCTCTGCAACTCGAGTTGCAGAGATGAACACGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000166226    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022573.1-799s1c1
Sequence:CCGGCCACAACAGCAGCCTTAACTTCTCGAGAAGTTAAGGCTGCTGTTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_022573
TSPY2 MISSION shRNA Lentiviral Transduction Particles
testis specific protein, Y-linked 2
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000166736    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022573.1-838s1c1
Sequence:CCGGCCACAACTTCGCAGGATCTAACTCGAGTTAGATCCTGCGAAGTTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000159575    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022573.1-682s1c1
Sequence:CCGGCCAGAATAAAGTGATTACCAACTCGAGTTGGTAATCACTTTATTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000160191    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022573.1-811s1c1
Sequence:CCGGCCTTAACTTCTTCAACTGGTTCTCGAGAACCAGTTGAAGAAGTTAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000162708    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022573.1-563s1c1
Sequence:CCGGCTGATCACTGACGAAGATGAACTCGAGTTCATCTTCGTCAGTGATCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000166131    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022573.1-826s1c1
Sequence:CCGGCTGGTTCTCTGACCACAACTTCTCGAGAAGTTGTGGTCAGAGAACCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000161962    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022573.1-807s1c1
Sequence:CCGGGCAGCCTTAACTTCTTCAACTCTCGAGAGTTGAAGAAGTTAAGGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000161647    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022573.1-734s1c1
Sequence:CCGGGCTTCTCATTCCACTCCAATTCTCGAGAATTGGAGTGGAATGAGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000161702    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022573.1-241s1c1
Sequence:CCGGGCTGCTGTTGGATGACATAATCTCGAGATTATGTCATCCAACAGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000165893    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022573.1-628s1c1
Sequence:CCGGGCATCGTGTTCATCTCTGCAACTCGAGTTGCAGAGATGAACACGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000166226    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022573.1-799s1c1
Sequence:CCGGCCACAACAGCAGCCTTAACTTCTCGAGAAGTTAAGGCTGCTGTTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks