EMAIL THIS PAGE TO A FRIEND

TSPY3

testis specific protein, Y-linked 3

Species: Human TSPY3(728137)
UniProtKB ID: P0CV98
Gene ID:
13 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1306174 ANTI-TSPY(C-TERMINAL) antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human
immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001077697 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001077697 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001077697 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001077697 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001077697 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00313156 predicted 530
2 SASI_Hs02_00313157 predicted 752
3 SASI_Hs02_00313158 predicted 520
4 SASI_Hs02_00313159 predicted 380
5 SASI_Hs02_00313160 predicted 495
6 SASI_Hs02_00313161 predicted 627
7 SASI_Hs02_00313162 predicted 652
8 SASI_Hs02_00313163 predicted 672
9 SASI_Hs02_00313164 predicted 532
10 SASI_Hs02_00313165 predicted 681
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001077697
TSPY3 MISSION shRNA Bacterial Glycerol Stock
testis specific protein, Y-linked 3
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000265693    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001077697.1-218s21c1
Sequence:CCGGTGCTGCTGTTGGATGACATAACTCGAGTTATGTCATCCAACAGCAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000255824    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001077697.1-730s21c1
Sequence:CCGGATTGAGTGGTATCCGGATTATCTCGAGATAATCCGGATACCACTCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000255825    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001077697.1-687s21c1
Sequence:CCGGTCTGGTGAACATCACAGAATACTCGAGTATTCTGTGATGTTCACCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000255827    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001077697.1-495s21c1
Sequence:CCGGTGGCTTCTGGGCCAATGTTATCTCGAGATAACATTGGCCCAGAAGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000255826    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001077697.1-631s21c1
Sequence:CCGGATGTTGTTCTTTCGGAGTAACCTCGAGGTTACTCCGAAAGAACAACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001077697
TSPY3 MISSION shRNA shRNA Plasmid DNA
testis specific protein, Y-linked 3
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000265693    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001077697.1-218s21c1
Sequence:CCGGTGCTGCTGTTGGATGACATAACTCGAGTTATGTCATCCAACAGCAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000255824    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001077697.1-730s21c1
Sequence:CCGGATTGAGTGGTATCCGGATTATCTCGAGATAATCCGGATACCACTCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000255825    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001077697.1-687s21c1
Sequence:CCGGTCTGGTGAACATCACAGAATACTCGAGTATTCTGTGATGTTCACCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000255827    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001077697.1-495s21c1
Sequence:CCGGTGGCTTCTGGGCCAATGTTATCTCGAGATAACATTGGCCCAGAAGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000255826    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001077697.1-631s21c1
Sequence:CCGGATGTTGTTCTTTCGGAGTAACCTCGAGGTTACTCCGAAAGAACAACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001077697
TSPY3 MISSION shRNA Lentiviral Transduction Particles
testis specific protein, Y-linked 3
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000265693    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001077697.1-218s21c1
Sequence:CCGGTGCTGCTGTTGGATGACATAACTCGAGTTATGTCATCCAACAGCAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000255824    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001077697.1-730s21c1
Sequence:CCGGATTGAGTGGTATCCGGATTATCTCGAGATAATCCGGATACCACTCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000255825    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001077697.1-687s21c1
Sequence:CCGGTCTGGTGAACATCACAGAATACTCGAGTATTCTGTGATGTTCACCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000255827    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001077697.1-495s21c1
Sequence:CCGGTGGCTTCTGGGCCAATGTTATCTCGAGATAACATTGGCCCAGAAGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000255826    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001077697.1-631s21c1
Sequence:CCGGATGTTGTTCTTTCGGAGTAACCTCGAGGTTACTCCGAAAGAACAACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks