EMAIL THIS PAGE TO A FRIEND

TSPYL1

TSPY-like 1

Synonyms: TSPYL
UniProtKB ID: Q9H0U9, O75885, Q5TFE6
Gene ID:
Human(7259) Summary: The protein encoded by this gene is found in the nucleolus and is similar to that of a family of genes on the Y-chromosome. This gene is intronless. Defects in this gene are a cause of sudden infant death with dysgenesis of the testes syndrome (SIDDT). [provided by RefSeq, Dec 2009]
Mouse(22110) testis-specific protein, Y-encoded-like 1
Rat(29544) TSPY-like 1
cow(538541) TSPY-like 1
sheep(101106177) TSPY-like 1
dog(481974) TSPY-like 1
142 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_003309 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003309 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003309 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_009433 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009433 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009433 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003309 Rosetta Predictions human pricing
NM_001013033 Rosetta Predictions rat pricing
NM_009433 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003309 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00335422 predicted 336
2 SASI_Hs02_00335423 predicted 1845
3 SASI_Hs02_00335424 predicted 1715
4 SASI_Hs01_00025431 predicted 1243
5 SASI_Hs01_00025434 predicted 1225
6 SASI_Hs01_00025435 predicted 1497
7 SASI_Hs02_00335425 predicted 1297
8 SASI_Hs02_00335426 predicted 1772
9 SASI_Hs02_00335427 predicted 1854
10 SASI_Hs02_00335428 predicted 337
11 SASI_Hs01_00025427 predicted 1528
12 SASI_Hs01_00025428 predicted 1719
13 SASI_Hs01_00025429 predicted 1533
14 SASI_Hs01_00025430 predicted 996
15 SASI_Hs01_00025432 predicted 1035
16 SASI_Hs01_00025433 predicted 1186
17 SASI_Hs01_00025436 predicted 1647
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001013033 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00061393 predicted 1470
2 SASI_Rn01_00061395 predicted 654
3 SASI_Rn01_00061396 predicted 866
4 SASI_Rn01_00061397 predicted 845
5 SASI_Rn02_00200614 predicted 798
6 SASI_Rn01_00061398 predicted 807
7 SASI_Rn01_00061399 predicted 1069
8 SASI_Rn02_00200615 predicted 858
9 SASI_Rn02_00200616 predicted 652
10 SASI_Rn01_00061401 predicted 390
11 SASI_Rn01_00061394 predicted 722
12 SASI_Rn01_00061400 predicted 757
13 SASI_Rn01_00061402 predicted 1287
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009433 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00146400 predicted 865
2 SASI_Mm01_00146401 predicted 754
3 SASI_Mm01_00146402 predicted 1164
4 SASI_Mm01_00146403 predicted 808
5 SASI_Mm02_00316127 predicted 1030
6 SASI_Mm02_00316128 predicted 854
7 SASI_Mm01_00146405 predicted 798
8 SASI_Mm01_00146406 predicted 725
9 SASI_Mm01_00146407 predicted 1074
10 SASI_Mm01_00146408 predicted 578
11 SASI_Mm01_00146404 predicted 673
12 SASI_Mm01_00146409 predicted 880
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003309
VALIDATED
TSPYL1 MISSION shRNA Bacterial Glycerol Stock
TSPY-like 1
Human
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000344195    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003309.2-1672s21c1
Sequence:CCGGGCAATGAGTATGCCTTCTATTCTCGAGAATAGAAGGCATACTCATTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000344141    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003309.2-1487s21c1
Sequence:CCGGGTGGCCAAATCCACTGCAATACTCGAGTATTGCAGTGGATTTGGCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000344140    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003309.2-873s21c1
Sequence:CCGGCCGCCAGAAGGTGAAGAAATACTCGAGTATTTCTTCACCTTCTGGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000344196    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003309.2-1718s21c1
Sequence:CCGGGCACCCTGTTTCCTTTGGATACTCGAGTATCCAAAGGAAACAGGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000145080    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_003309.1-1030s1c1
Sequence:CCGGGCAGAGATGTTAAGGTACATACTCGAGTATGTACCTTAACATCTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000142324    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003309.1-1354s1c1
Sequence:CCGGCAATACTACCTGTTGCGTGAACTCGAGTTCACGCAACAGGTAGTATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000141937    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_003309.1-2386s1c1
Sequence:CCGGGCAAAGAAGTTGGCCTGTAAACTCGAGTTTACAGGCCAACTTCTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000139973    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_003309.1-1241s1c1
Sequence:CCGGGCAGAAACCAAGACCTCATCTCTCGAGAGATGAGGTCTTGGTTTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000139997    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_003309.1-1338s1c1
Sequence:CCGGGTGGCCAAATCCACTGCAATACTCGAGTATTGCAGTGGATTTGGCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000139838    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_003309.1-724s1c1
Sequence:CCGGCCGCCAGAAGGTGAAGAAATACTCGAGTATTTCTTCACCTTCTGGCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000140845    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_003309.1-1227s1c1
Sequence:CCGGCCAGTCCTTCATTCGCAGAAACTCGAGTTTCTGCGAATGAAGGACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000122627    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_003309.1-1569s1c1
Sequence:CCGGGCACCCTGTTTCCTTTGGATACTCGAGTATCCAAAGGAAACAGGGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000121676    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_003309.1-1523s1c1
Sequence:CCGGGCAATGAGTATGCCTTCTATTCTCGAGAATAGAAGGCATACTCATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003309
VALIDATED
TSPYL1 MISSION shRNA shRNA Plasmid DNA
TSPY-like 1
Human
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000344195    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003309.2-1672s21c1
Sequence:CCGGGCAATGAGTATGCCTTCTATTCTCGAGAATAGAAGGCATACTCATTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000344141    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003309.2-1487s21c1
Sequence:CCGGGTGGCCAAATCCACTGCAATACTCGAGTATTGCAGTGGATTTGGCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000344140    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003309.2-873s21c1
Sequence:CCGGCCGCCAGAAGGTGAAGAAATACTCGAGTATTTCTTCACCTTCTGGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000344196    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003309.2-1718s21c1
Sequence:CCGGGCACCCTGTTTCCTTTGGATACTCGAGTATCCAAAGGAAACAGGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000145080    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_003309.1-1030s1c1
Sequence:CCGGGCAGAGATGTTAAGGTACATACTCGAGTATGTACCTTAACATCTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000142324    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003309.1-1354s1c1
Sequence:CCGGCAATACTACCTGTTGCGTGAACTCGAGTTCACGCAACAGGTAGTATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000141937    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_003309.1-2386s1c1
Sequence:CCGGGCAAAGAAGTTGGCCTGTAAACTCGAGTTTACAGGCCAACTTCTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000139973    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_003309.1-1241s1c1
Sequence:CCGGGCAGAAACCAAGACCTCATCTCTCGAGAGATGAGGTCTTGGTTTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000139997    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_003309.1-1338s1c1
Sequence:CCGGGTGGCCAAATCCACTGCAATACTCGAGTATTGCAGTGGATTTGGCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000139838    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_003309.1-724s1c1
Sequence:CCGGCCGCCAGAAGGTGAAGAAATACTCGAGTATTTCTTCACCTTCTGGCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000140845    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_003309.1-1227s1c1
Sequence:CCGGCCAGTCCTTCATTCGCAGAAACTCGAGTTTCTGCGAATGAAGGACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000122627    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_003309.1-1569s1c1
Sequence:CCGGGCACCCTGTTTCCTTTGGATACTCGAGTATCCAAAGGAAACAGGGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000121676    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_003309.1-1523s1c1
Sequence:CCGGGCAATGAGTATGCCTTCTATTCTCGAGAATAGAAGGCATACTCATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003309
VALIDATED
TSPYL1 MISSION shRNA Lentiviral Transduction Particles
TSPY-like 1
Human
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000344195    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003309.2-1672s21c1
Sequence:CCGGGCAATGAGTATGCCTTCTATTCTCGAGAATAGAAGGCATACTCATTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000344141    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003309.2-1487s21c1
Sequence:CCGGGTGGCCAAATCCACTGCAATACTCGAGTATTGCAGTGGATTTGGCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000344140    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003309.2-873s21c1
Sequence:CCGGCCGCCAGAAGGTGAAGAAATACTCGAGTATTTCTTCACCTTCTGGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000344196    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003309.2-1718s21c1
Sequence:CCGGGCACCCTGTTTCCTTTGGATACTCGAGTATCCAAAGGAAACAGGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000145080    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_003309.1-1030s1c1
Sequence:CCGGGCAGAGATGTTAAGGTACATACTCGAGTATGTACCTTAACATCTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000142324    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003309.1-1354s1c1
Sequence:CCGGCAATACTACCTGTTGCGTGAACTCGAGTTCACGCAACAGGTAGTATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000141937    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_003309.1-2386s1c1
Sequence:CCGGGCAAAGAAGTTGGCCTGTAAACTCGAGTTTACAGGCCAACTTCTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000139973    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_003309.1-1241s1c1
Sequence:CCGGGCAGAAACCAAGACCTCATCTCTCGAGAGATGAGGTCTTGGTTTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000139997    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_003309.1-1338s1c1
Sequence:CCGGGTGGCCAAATCCACTGCAATACTCGAGTATTGCAGTGGATTTGGCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000139838    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_003309.1-724s1c1
Sequence:CCGGCCGCCAGAAGGTGAAGAAATACTCGAGTATTTCTTCACCTTCTGGCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000140845    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_003309.1-1227s1c1
Sequence:CCGGCCAGTCCTTCATTCGCAGAAACTCGAGTTTCTGCGAATGAAGGACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000122627    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_003309.1-1569s1c1
Sequence:CCGGGCACCCTGTTTCCTTTGGATACTCGAGTATCCAAAGGAAACAGGGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000121676    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_003309.1-1523s1c1
Sequence:CCGGGCAATGAGTATGCCTTCTATTCTCGAGAATAGAAGGCATACTCATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009433
VALIDATED
TSPYL1 MISSION shRNA Bacterial Glycerol Stock
TSPY-like 1
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000308691    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009433.2-953s21c1
Sequence:CCGGCCAGTCCTTCATTCGCAGAAACTCGAGTTTCTGCGAATGAAGGACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000308634    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009433.2-863s21c1
Sequence:CCGGCAAGCTGATTGTCAAGGAATACTCGAGTATTCCTTGACAATCAGCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000305081    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009433.2-1633s21c1
Sequence:CCGGGCACCACTTTCTAGGTTATATCTCGAGATATAACCTAGAAAGTGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000305144    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009433.2-724s21c1
Sequence:CCGGCTCAGTTGTCCGCCATGATTACTCGAGTAATCATGGCGGACAACTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000308692    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009433.2-756s21c1
Sequence:CCGGGCAGAGATGTTAAGGTACGTACTCGAGTACGTACCTTAACATCTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000106390    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009433.2-1387s1c1
Sequence:CCGGCCTGGCTTATACCCTTTCTAACTCGAGTTAGAAAGGGTATAAGCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000106392    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009433.2-756s1c1
Sequence:CCGGGCAGAGATGTTAAGGTACGTACTCGAGTACGTACCTTAACATCTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000106394    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009433.2-299s1c1
Sequence:CCGGGACACCGAAATATGTGGAGAACTCGAGTTCTCCACATATTTCGGTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000106393    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009433.2-863s1c1
Sequence:CCGGCAAGCTGATTGTCAAGGAATACTCGAGTATTCCTTGACAATCAGCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000106391    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009433.2-953s1c1
Sequence:CCGGCCAGTCCTTCATTCGCAGAAACTCGAGTTTCTGCGAATGAAGGACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009433
VALIDATED
TSPYL1 MISSION shRNA shRNA Plasmid DNA
TSPY-like 1
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000308691    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009433.2-953s21c1
Sequence:CCGGCCAGTCCTTCATTCGCAGAAACTCGAGTTTCTGCGAATGAAGGACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000308634    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009433.2-863s21c1
Sequence:CCGGCAAGCTGATTGTCAAGGAATACTCGAGTATTCCTTGACAATCAGCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000305081    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009433.2-1633s21c1
Sequence:CCGGGCACCACTTTCTAGGTTATATCTCGAGATATAACCTAGAAAGTGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000305144    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009433.2-724s21c1
Sequence:CCGGCTCAGTTGTCCGCCATGATTACTCGAGTAATCATGGCGGACAACTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000308692    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009433.2-756s21c1
Sequence:CCGGGCAGAGATGTTAAGGTACGTACTCGAGTACGTACCTTAACATCTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000106390    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009433.2-1387s1c1
Sequence:CCGGCCTGGCTTATACCCTTTCTAACTCGAGTTAGAAAGGGTATAAGCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000106392    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009433.2-756s1c1
Sequence:CCGGGCAGAGATGTTAAGGTACGTACTCGAGTACGTACCTTAACATCTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000106394    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009433.2-299s1c1
Sequence:CCGGGACACCGAAATATGTGGAGAACTCGAGTTCTCCACATATTTCGGTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000106393    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009433.2-863s1c1
Sequence:CCGGCAAGCTGATTGTCAAGGAATACTCGAGTATTCCTTGACAATCAGCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000106391    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009433.2-953s1c1
Sequence:CCGGCCAGTCCTTCATTCGCAGAAACTCGAGTTTCTGCGAATGAAGGACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009433
VALIDATED
TSPYL1 MISSION shRNA Lentiviral Transduction Particles
TSPY-like 1
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000308691    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009433.2-953s21c1
Sequence:CCGGCCAGTCCTTCATTCGCAGAAACTCGAGTTTCTGCGAATGAAGGACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000308634    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009433.2-863s21c1
Sequence:CCGGCAAGCTGATTGTCAAGGAATACTCGAGTATTCCTTGACAATCAGCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000305081    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009433.2-1633s21c1
Sequence:CCGGGCACCACTTTCTAGGTTATATCTCGAGATATAACCTAGAAAGTGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000305144    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009433.2-724s21c1
Sequence:CCGGCTCAGTTGTCCGCCATGATTACTCGAGTAATCATGGCGGACAACTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000308692    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009433.2-756s21c1
Sequence:CCGGGCAGAGATGTTAAGGTACGTACTCGAGTACGTACCTTAACATCTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000106390    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009433.2-1387s1c1
Sequence:CCGGCCTGGCTTATACCCTTTCTAACTCGAGTTAGAAAGGGTATAAGCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000106392    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009433.2-756s1c1
Sequence:CCGGGCAGAGATGTTAAGGTACGTACTCGAGTACGTACCTTAACATCTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000106394    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009433.2-299s1c1
Sequence:CCGGGACACCGAAATATGTGGAGAACTCGAGTTCTCCACATATTTCGGTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000106393    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009433.2-863s1c1
Sequence:CCGGCAAGCTGATTGTCAAGGAATACTCGAGTATTCCTTGACAATCAGCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000106391    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009433.2-953s1c1
Sequence:CCGGCCAGTCCTTCATTCGCAGAAACTCGAGTTTCTGCGAATGAAGGACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks