EMAIL THIS PAGE TO A FRIEND

TSPYL2

TSPY-like 2

Synonyms: CDA1 CINAP CTCL DENTT HRIHFB2216 NP79 SE204 TSPX
UniProtKB ID: Q9H2G4, O94799, Q96DG7, Q9BZW6
Gene ID:
Human(64061) Summary: This gene encodes a member of the testis-specific protein Y-encoded, TSPY-like/SET/nucleosome assembly protein-1 superfamily. The encoded protein is localized to the nucleolus where it functions in chromatin remodeling and as an inhibitor of cell-cycle progression. This protein may play a role in the suppression of tumor growth. [provided by RefSeq, Sep 2009]
Mouse(52808) TSPY-like 2
Rat(302612) TSPY-like 2
dog(491893) TSPY-like 2
cow(617179) TSPY-like 2
sheep(101110211) TSPY-like 2
256 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_022117 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_022117 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_022117 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_145936 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_145936 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_145936 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU018321 MISSION® esiRNA esiRNA targeting human TSPYL2 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_022117 Rosetta Predictions human pricing
XM_001064403 Rosetta Predictions rat pricing
XM_217607 Rosetta Predictions rat pricing
NM_029836 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022117 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00176921 predicted 2322
2 SASI_Hs01_00176922 predicted 2322
3 SASI_Hs01_00176923 predicted 1084
4 SASI_Hs01_00176924 predicted 1021
5 SASI_Hs01_00176925 predicted 2352
6 SASI_Hs01_00176926 predicted 2319
7 SASI_Hs01_00176927 predicted 1341
8 SASI_Hs01_00176928 predicted 2314
9 SASI_Hs01_00176920 predicted 2141
10 SASI_Hs01_00176929 predicted 1266
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001064403 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00310324 predicted 1448
2 SASI_Rn02_00310325 predicted 1049
3 SASI_Rn02_00310326 predicted 1279
4 SASI_Rn02_00310327 predicted 1358
5 SASI_Rn02_00310328 predicted 1460
6 SASI_Rn02_00310329 predicted 1371
7 SASI_Rn02_00310330 predicted 398
8 SASI_Rn02_00310331 predicted 1386
9 SASI_Rn02_00310332 predicted 1358
10 SASI_Rn02_00310333 predicted 1547
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_217607 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00377245 predicted 1453
2 SASI_Rn02_00377246 predicted 1316
3 SASI_Rn02_00377247 predicted 1270
4 SASI_Rn02_00377248 predicted 1278
5 SASI_Rn02_00377249 predicted 1484
6 SASI_Rn02_00377250 predicted 1361
7 SASI_Rn02_00377251 predicted 1459
8 SASI_Rn02_00377252 predicted 1372
9 SASI_Rn02_00377253 predicted 1391
10 SASI_Rn02_00377254 predicted 1362
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_029836 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00336024 predicted 1036
2 SASI_Mm01_00134920 predicted 1087
3 SASI_Mm01_00134921 predicted 1364
4 SASI_Mm01_00134923 predicted 374
5 SASI_Mm01_00134924 predicted 961
6 SASI_Mm01_00134925 predicted 1214
7 SASI_Mm01_00134927 predicted 1523
8 SASI_Mm02_00336025 predicted 1362
9 SASI_Mm01_00134928 predicted 1407
10 SASI_Mm01_00134929 predicted 405
11 SASI_Mm01_00134922 predicted 1346
12 SASI_Mm01_00134926 predicted 370
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_022117
VALIDATED
TSPYL2 MISSION shRNA Bacterial Glycerol Stock
TSPY-like 2
Human
16 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000117982    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_022117.1-2322s1c1
Sequence:CCGGCGACTTCGTACACGGGTTTAACTCGAGTTAAACCCGTGTACGAAGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000117983    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_022117.1-1734s1c1
Sequence:CCGGCGAGAACACTTACGGCAACAACTCGAGTTGTTGCCGTAAGTGTTCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000117985    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022117.1-1632s1c1
Sequence:CCGGCCACGAAACCACTGACAACAACTCGAGTTGTTGTCAGTGGTTTCGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000117986    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_022117.1-1449s1c1
Sequence:CCGGCTCAGACATTGATGAGACAATCTCGAGATTGTCTCATCAATGTCTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000117984    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_022117.1-631s1c1
Sequence:CCGGGCGATCATCATAGTGGAGGATCTCGAGATCCTCCACTATGATGATCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000130789    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_022117.1-2323s1c1
Sequence:CCGGGACTTCGTACACGGGTTTAAACTCGAGTTTAAACCCGTGTACGAAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000129399    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022117.1-854s1c1
Sequence:CCGGGCAAGTTCATCCAGATGCGAACTCGAGTTCGCATCTGGATGAACTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000130233    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022117.1-1449s1c2
Sequence:CCGGCTCAGACATTGATGAGACAATCTCGAGATTGTCTCATCAATGTCTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000127532    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_022117.1-1593s1c1
Sequence:CCGGCAACAACGAGACCACTGATAACTCGAGTTATCAGTGGTCTCGTTGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000127950    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_022117.1-1030s1c1
Sequence:CCGGCATATCTCCATGGGCTACAAACTCGAGTTTGTAGCCCATGGAGATATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000369752    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022117.2-779s21c1
Sequence:CCGGTGCAGGCACTGGAGGATATTCCTCGAGGAATATCCTCCAGTGCCTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000349134    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022117.2-2325s21c1
Sequence:CCGGCGACTTCGTACACGGGTTTAACTCGAGTTAAACCCGTGTACGAAGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000303520    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022117.2-1596s21c1
Sequence:CCGGCAACAACGAGACCACTGATAACTCGAGTTATCAGTGGTCTCGTTGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000303521    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022117.2-1985s21c1
Sequence:CCGGCTGACTACGAGGACGTGATAGCTCGAGCTATCACGTCCTCGTAGTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000303519    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022117.2-1033s21c1
Sequence:CCGGCATATCTCCATGGGCTACAAACTCGAGTTTGTAGCCCATGGAGATATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000315832    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022117.2-634s21c1
Sequence:CCGGGCGATCATCATAGTGGAGGATCTCGAGATCCTCCACTATGATGATCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_022117
VALIDATED
TSPYL2 MISSION shRNA shRNA Plasmid DNA
TSPY-like 2
Human
16 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000117982    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_022117.1-2322s1c1
Sequence:CCGGCGACTTCGTACACGGGTTTAACTCGAGTTAAACCCGTGTACGAAGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000117983    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_022117.1-1734s1c1
Sequence:CCGGCGAGAACACTTACGGCAACAACTCGAGTTGTTGCCGTAAGTGTTCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000117985    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022117.1-1632s1c1
Sequence:CCGGCCACGAAACCACTGACAACAACTCGAGTTGTTGTCAGTGGTTTCGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000117986    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_022117.1-1449s1c1
Sequence:CCGGCTCAGACATTGATGAGACAATCTCGAGATTGTCTCATCAATGTCTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000117984    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_022117.1-631s1c1
Sequence:CCGGGCGATCATCATAGTGGAGGATCTCGAGATCCTCCACTATGATGATCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000130789    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_022117.1-2323s1c1
Sequence:CCGGGACTTCGTACACGGGTTTAAACTCGAGTTTAAACCCGTGTACGAAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000129399    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022117.1-854s1c1
Sequence:CCGGGCAAGTTCATCCAGATGCGAACTCGAGTTCGCATCTGGATGAACTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000130233    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022117.1-1449s1c2
Sequence:CCGGCTCAGACATTGATGAGACAATCTCGAGATTGTCTCATCAATGTCTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000127532    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_022117.1-1593s1c1
Sequence:CCGGCAACAACGAGACCACTGATAACTCGAGTTATCAGTGGTCTCGTTGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000127950    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_022117.1-1030s1c1
Sequence:CCGGCATATCTCCATGGGCTACAAACTCGAGTTTGTAGCCCATGGAGATATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000369752    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022117.2-779s21c1
Sequence:CCGGTGCAGGCACTGGAGGATATTCCTCGAGGAATATCCTCCAGTGCCTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000349134    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022117.2-2325s21c1
Sequence:CCGGCGACTTCGTACACGGGTTTAACTCGAGTTAAACCCGTGTACGAAGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000303520    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022117.2-1596s21c1
Sequence:CCGGCAACAACGAGACCACTGATAACTCGAGTTATCAGTGGTCTCGTTGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000303521    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022117.2-1985s21c1
Sequence:CCGGCTGACTACGAGGACGTGATAGCTCGAGCTATCACGTCCTCGTAGTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000303519    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022117.2-1033s21c1
Sequence:CCGGCATATCTCCATGGGCTACAAACTCGAGTTTGTAGCCCATGGAGATATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000315832    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022117.2-634s21c1
Sequence:CCGGGCGATCATCATAGTGGAGGATCTCGAGATCCTCCACTATGATGATCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_022117
VALIDATED
TSPYL2 MISSION shRNA Lentiviral Transduction Particles
TSPY-like 2
Human
16 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000117982    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_022117.1-2322s1c1
Sequence:CCGGCGACTTCGTACACGGGTTTAACTCGAGTTAAACCCGTGTACGAAGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000117983    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_022117.1-1734s1c1
Sequence:CCGGCGAGAACACTTACGGCAACAACTCGAGTTGTTGCCGTAAGTGTTCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000117985    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022117.1-1632s1c1
Sequence:CCGGCCACGAAACCACTGACAACAACTCGAGTTGTTGTCAGTGGTTTCGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000117986    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_022117.1-1449s1c1
Sequence:CCGGCTCAGACATTGATGAGACAATCTCGAGATTGTCTCATCAATGTCTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000117984    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_022117.1-631s1c1
Sequence:CCGGGCGATCATCATAGTGGAGGATCTCGAGATCCTCCACTATGATGATCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000130789    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_022117.1-2323s1c1
Sequence:CCGGGACTTCGTACACGGGTTTAAACTCGAGTTTAAACCCGTGTACGAAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000129399    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022117.1-854s1c1
Sequence:CCGGGCAAGTTCATCCAGATGCGAACTCGAGTTCGCATCTGGATGAACTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000130233    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022117.1-1449s1c2
Sequence:CCGGCTCAGACATTGATGAGACAATCTCGAGATTGTCTCATCAATGTCTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000127532    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_022117.1-1593s1c1
Sequence:CCGGCAACAACGAGACCACTGATAACTCGAGTTATCAGTGGTCTCGTTGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000127950    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_022117.1-1030s1c1
Sequence:CCGGCATATCTCCATGGGCTACAAACTCGAGTTTGTAGCCCATGGAGATATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000369752    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022117.2-779s21c1
Sequence:CCGGTGCAGGCACTGGAGGATATTCCTCGAGGAATATCCTCCAGTGCCTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000349134    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022117.2-2325s21c1
Sequence:CCGGCGACTTCGTACACGGGTTTAACTCGAGTTAAACCCGTGTACGAAGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000303520    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022117.2-1596s21c1
Sequence:CCGGCAACAACGAGACCACTGATAACTCGAGTTATCAGTGGTCTCGTTGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000303521    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022117.2-1985s21c1
Sequence:CCGGCTGACTACGAGGACGTGATAGCTCGAGCTATCACGTCCTCGTAGTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000303519    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022117.2-1033s21c1
Sequence:CCGGCATATCTCCATGGGCTACAAACTCGAGTTTGTAGCCCATGGAGATATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000315832    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022117.2-634s21c1
Sequence:CCGGGCGATCATCATAGTGGAGGATCTCGAGATCCTCCACTATGATGATCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_145936
TSPYL2 MISSION shRNA Bacterial Glycerol Stock
TSPY-like 2
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000125670    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145936.3-535s1c1
Sequence:CCGGGCCCTAGAAACCTGTAGCTTACTCGAGTAAGCTACAGGTTTCTAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000125672    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145936.3-810s1c1
Sequence:CCGGGCGTCTCAAGCGCAAATTCATCTCGAGATGAATTTGCGCTTGAGACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000125673    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145936.3-570s1c1
Sequence:CCGGCCAGATGTTAGTTGGTCCGAACTCGAGTTCGGACCAACTAACATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000125671    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145936.3-325s1c1
Sequence:CCGGCCACTGCCCTATGTCATTCTTCTCGAGAAGAATGACATAGGGCAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000125669    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145936.3-1428s1c1
Sequence:CCGGCGGAAAGGAAAGAGCCAAGAACTCGAGTTCTTGGCTCTTTCCTTTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_145936
TSPYL2 MISSION shRNA shRNA Plasmid DNA
TSPY-like 2
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000125670    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145936.3-535s1c1
Sequence:CCGGGCCCTAGAAACCTGTAGCTTACTCGAGTAAGCTACAGGTTTCTAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000125672    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145936.3-810s1c1
Sequence:CCGGGCGTCTCAAGCGCAAATTCATCTCGAGATGAATTTGCGCTTGAGACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000125673    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145936.3-570s1c1
Sequence:CCGGCCAGATGTTAGTTGGTCCGAACTCGAGTTCGGACCAACTAACATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000125671    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145936.3-325s1c1
Sequence:CCGGCCACTGCCCTATGTCATTCTTCTCGAGAAGAATGACATAGGGCAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000125669    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145936.3-1428s1c1
Sequence:CCGGCGGAAAGGAAAGAGCCAAGAACTCGAGTTCTTGGCTCTTTCCTTTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_145936
TSPYL2 MISSION shRNA Lentiviral Transduction Particles
TSPY-like 2
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000125670    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145936.3-535s1c1
Sequence:CCGGGCCCTAGAAACCTGTAGCTTACTCGAGTAAGCTACAGGTTTCTAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000125672    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145936.3-810s1c1
Sequence:CCGGGCGTCTCAAGCGCAAATTCATCTCGAGATGAATTTGCGCTTGAGACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000125673    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145936.3-570s1c1
Sequence:CCGGCCAGATGTTAGTTGGTCCGAACTCGAGTTCGGACCAACTAACATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000125671    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145936.3-325s1c1
Sequence:CCGGCCACTGCCCTATGTCATTCTTCTCGAGAAGAATGACATAGGGCAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000125669    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145936.3-1428s1c1
Sequence:CCGGCGGAAAGGAAAGAGCCAAGAACTCGAGTTCTTGGCTCTTTCCTTTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks