EMAIL THIS PAGE TO A FRIEND

TSPYL4

TSPY-like 4

Synonyms: dJ486I3.2
UniProtKB ID: Q9UJ04, B4DYQ2, O94828, Q96GW8
Gene ID:
Mouse(72480) TSPY-like 4
Rat(309828) TSPY-like 4
cow(508104) TSPY-like 4
sheep(101105335) TSPY-like 4
dog(481973) TSPY-like 4
117 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_021648 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_021648 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_021648 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_030203 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_030203 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_030203 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_021648 Rosetta Predictions human pricing
NM_001012075 Rosetta Predictions rat pricing
XM_574780 Rosetta Predictions rat pricing
NM_030203 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021648 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00195023 predicted 614
2 SASI_Hs01_00195024 predicted 1447
3 SASI_Hs01_00195025 predicted 528
4 SASI_Hs01_00195026 predicted 1188
5 SASI_Hs01_00195027 predicted 1329
6 SASI_Hs01_00195028 predicted 1491
7 SASI_Hs01_00195029 predicted 1426
8 SASI_Hs01_00195030 predicted 1591
9 SASI_Hs01_00195032 predicted 883
10 SASI_Hs02_00355027 predicted 1540
11 SASI_Hs01_00195031 predicted 1023
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001012075 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00038867 predicted 473
2 SASI_Rn01_00038868 predicted 656
3 SASI_Rn01_00038869 predicted 859
4 SASI_Rn01_00038871 predicted 1088
5 SASI_Rn01_00038872 predicted 1048
6 SASI_Rn01_00038874 predicted 819
7 SASI_Rn01_00038875 predicted 720
8 SASI_Rn01_00038876 predicted 729
9 SASI_Rn02_00200190 predicted 1110
10 SASI_Rn02_00200191 predicted 1085
11 SASI_Rn01_00038870 predicted 1318
12 SASI_Rn01_00038873 predicted 1265
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_574780 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00154828 predicted 477
2 SASI_Rn01_00154829 predicted 665
3 SASI_Rn01_00154830 predicted 863
4 SASI_Rn01_00154831 predicted 1327
5 SASI_Rn01_00154832 predicted 1091
6 SASI_Rn01_00154833 predicted 1059
7 SASI_Rn01_00154834 predicted 1261
8 SASI_Rn01_00154835 predicted 825
9 SASI_Rn01_00154836 predicted 727
10 SASI_Rn01_00154837 predicted 739
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_030203 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00039158 predicted 655
2 SASI_Mm01_00039160 predicted 938
3 SASI_Mm01_00039161 predicted 1394
4 SASI_Mm01_00039162 predicted 887
5 SASI_Mm01_00039163 predicted 693
6 SASI_Mm01_00039164 predicted 817
7 SASI_Mm02_00336624 predicted 1149
8 SASI_Mm01_00039166 predicted 748
9 SASI_Mm01_00039167 predicted 1314
10 SASI_Mm02_00336625 predicted 1388
11 SASI_Mm01_00039159 predicted 1113
12 SASI_Mm01_00039165 predicted 286
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_021648
VALIDATED
TSPYL4 MISSION shRNA Bacterial Glycerol Stock
TSPY-like 4
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000136067    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021648.4-810s1c1
Sequence:CCGGGCAGCGCAGAAGTTTCATTATCTCGAGATAATGAAACTTCTGCGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000135189    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021648.4-978s1c1
Sequence:CCGGCAAGTTCATCTTTCAGGGCAACTCGAGTTGCCCTGAAAGATGAACTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000135731    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021648.4-2009s1c1
Sequence:CCGGCCTGTACCTTTGGTTACTCTACTCGAGTAGAGTAACCAAAGGTACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000135063    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021648.4-1144s1c1
Sequence:CCGGCCTAGTTTCTTCAACTGGTTTCTCGAGAAACCAGTTGAAGAAACTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000133877    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_021648.4-1673s1c1
Sequence:CCGGCCCAATTTAAGTGGTTCTGTACTCGAGTACAGAACCACTTAAATTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000133641    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021648.4-721s1c1
Sequence:CCGGGATCAAGAGTTGTCAAACGTACTCGAGTACGTTTGACAACTCTTGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000134648    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_021648.4-968s1c1
Sequence:CCGGGCTGCAAATTCAAGTTCATCTCTCGAGAGATGAACTTGAATTTGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000350827    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021648.4-767s21c1
Sequence:CCGGTTCAGCTTGAGCGCAAGTTTGCTCGAGCAAACTTGCGCTCAAGCTGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000350770    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021648.4-1662s21c1
Sequence:CCGGCATGCTCTTCTCCCAATTTAACTCGAGTTAAATTGGGAGAAGAGCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000336897    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021648.4-914s21c1
Sequence:CCGGTGCTGAGGTACATGATCAATTCTCGAGAATTGATCATGTACCTCAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000336896    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_021648.4-724s21c1
Sequence:CCGGCAAGAGTTGTCAAACGTAAATCTCGAGATTTACGTTTGACAACTCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000336895    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021648.4-535s21c1
Sequence:CCGGGCCAAGGAAGTGACGACTAAACTCGAGTTTAGTCGTCACTTCCTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_021648
VALIDATED
TSPYL4 MISSION shRNA shRNA Plasmid DNA
TSPY-like 4
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000136067    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021648.4-810s1c1
Sequence:CCGGGCAGCGCAGAAGTTTCATTATCTCGAGATAATGAAACTTCTGCGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000135189    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021648.4-978s1c1
Sequence:CCGGCAAGTTCATCTTTCAGGGCAACTCGAGTTGCCCTGAAAGATGAACTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000135731    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021648.4-2009s1c1
Sequence:CCGGCCTGTACCTTTGGTTACTCTACTCGAGTAGAGTAACCAAAGGTACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000135063    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021648.4-1144s1c1
Sequence:CCGGCCTAGTTTCTTCAACTGGTTTCTCGAGAAACCAGTTGAAGAAACTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000133877    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_021648.4-1673s1c1
Sequence:CCGGCCCAATTTAAGTGGTTCTGTACTCGAGTACAGAACCACTTAAATTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000133641    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021648.4-721s1c1
Sequence:CCGGGATCAAGAGTTGTCAAACGTACTCGAGTACGTTTGACAACTCTTGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000134648    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_021648.4-968s1c1
Sequence:CCGGGCTGCAAATTCAAGTTCATCTCTCGAGAGATGAACTTGAATTTGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000350827    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021648.4-767s21c1
Sequence:CCGGTTCAGCTTGAGCGCAAGTTTGCTCGAGCAAACTTGCGCTCAAGCTGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000350770    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021648.4-1662s21c1
Sequence:CCGGCATGCTCTTCTCCCAATTTAACTCGAGTTAAATTGGGAGAAGAGCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000336897    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021648.4-914s21c1
Sequence:CCGGTGCTGAGGTACATGATCAATTCTCGAGAATTGATCATGTACCTCAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000336896    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_021648.4-724s21c1
Sequence:CCGGCAAGAGTTGTCAAACGTAAATCTCGAGATTTACGTTTGACAACTCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000336895    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021648.4-535s21c1
Sequence:CCGGGCCAAGGAAGTGACGACTAAACTCGAGTTTAGTCGTCACTTCCTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_021648
VALIDATED
TSPYL4 MISSION shRNA Lentiviral Transduction Particles
TSPY-like 4
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000136067    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021648.4-810s1c1
Sequence:CCGGGCAGCGCAGAAGTTTCATTATCTCGAGATAATGAAACTTCTGCGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000135189    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021648.4-978s1c1
Sequence:CCGGCAAGTTCATCTTTCAGGGCAACTCGAGTTGCCCTGAAAGATGAACTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000135731    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021648.4-2009s1c1
Sequence:CCGGCCTGTACCTTTGGTTACTCTACTCGAGTAGAGTAACCAAAGGTACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000135063    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021648.4-1144s1c1
Sequence:CCGGCCTAGTTTCTTCAACTGGTTTCTCGAGAAACCAGTTGAAGAAACTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000133877    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_021648.4-1673s1c1
Sequence:CCGGCCCAATTTAAGTGGTTCTGTACTCGAGTACAGAACCACTTAAATTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000133641    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021648.4-721s1c1
Sequence:CCGGGATCAAGAGTTGTCAAACGTACTCGAGTACGTTTGACAACTCTTGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000134648    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_021648.4-968s1c1
Sequence:CCGGGCTGCAAATTCAAGTTCATCTCTCGAGAGATGAACTTGAATTTGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000350827    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021648.4-767s21c1
Sequence:CCGGTTCAGCTTGAGCGCAAGTTTGCTCGAGCAAACTTGCGCTCAAGCTGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000350770    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021648.4-1662s21c1
Sequence:CCGGCATGCTCTTCTCCCAATTTAACTCGAGTTAAATTGGGAGAAGAGCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000336897    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021648.4-914s21c1
Sequence:CCGGTGCTGAGGTACATGATCAATTCTCGAGAATTGATCATGTACCTCAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000336896    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_021648.4-724s21c1
Sequence:CCGGCAAGAGTTGTCAAACGTAAATCTCGAGATTTACGTTTGACAACTCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000336895    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021648.4-535s21c1
Sequence:CCGGGCCAAGGAAGTGACGACTAAACTCGAGTTTAGTCGTCACTTCCTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_030203
TSPYL4 MISSION shRNA Bacterial Glycerol Stock
TSPY-like 4
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000012073    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_030203.1-1811s1c1
Sequence:CCGGCCCTGCTTGTTATCTCTACAACTCGAGTTGTAGAGATAACAAGCAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000012075    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030203.1-1102s1c1
Sequence:CCGGGCCTCCTAGAATTCGACAGAACTCGAGTTCTGTCGAATTCTAGGAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000012076    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030203.1-455s1c1
Sequence:CCGGGCCGAAGAAGACCAAGGAAATCTCGAGATTTCCTTGGTCTTCTTCGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000012074    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030203.1-737s1c1
Sequence:CCGGGCAGCGCAGAAGTTTCATCATCTCGAGATGATGAAACTTCTGCGCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000012077    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030203.1-884s1c1
Sequence:CCGGGCCAAGAGTAGGGTGCAAATTCTCGAGAATTTGCACCCTACTCTTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_030203
TSPYL4 MISSION shRNA shRNA Plasmid DNA
TSPY-like 4
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000012073    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_030203.1-1811s1c1
Sequence:CCGGCCCTGCTTGTTATCTCTACAACTCGAGTTGTAGAGATAACAAGCAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000012075    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030203.1-1102s1c1
Sequence:CCGGGCCTCCTAGAATTCGACAGAACTCGAGTTCTGTCGAATTCTAGGAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000012076    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030203.1-455s1c1
Sequence:CCGGGCCGAAGAAGACCAAGGAAATCTCGAGATTTCCTTGGTCTTCTTCGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000012074    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030203.1-737s1c1
Sequence:CCGGGCAGCGCAGAAGTTTCATCATCTCGAGATGATGAAACTTCTGCGCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000012077    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030203.1-884s1c1
Sequence:CCGGGCCAAGAGTAGGGTGCAAATTCTCGAGAATTTGCACCCTACTCTTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_030203
TSPYL4 MISSION shRNA Lentiviral Transduction Particles
TSPY-like 4
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000012073    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_030203.1-1811s1c1
Sequence:CCGGCCCTGCTTGTTATCTCTACAACTCGAGTTGTAGAGATAACAAGCAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000012075    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030203.1-1102s1c1
Sequence:CCGGGCCTCCTAGAATTCGACAGAACTCGAGTTCTGTCGAATTCTAGGAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000012076    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030203.1-455s1c1
Sequence:CCGGGCCGAAGAAGACCAAGGAAATCTCGAGATTTCCTTGGTCTTCTTCGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000012074    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030203.1-737s1c1
Sequence:CCGGGCAGCGCAGAAGTTTCATCATCTCGAGATGATGAAACTTCTGCGCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000012077    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030203.1-884s1c1
Sequence:CCGGGCCAAGAGTAGGGTGCAAATTCTCGAGAATTTGCACCCTACTCTTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks