EMAIL THIS PAGE TO A FRIEND

TSPYL5

TSPY-like 5

UniProtKB ID: Q86VY4, B3KRF0, Q9C0B3
Gene ID:
Mouse(239364) testis-specific protein, Y-encoded-like 5
Rat(314555) TSPY-like 5
dog(487063) TSPY-like 5
cow(615997) TSPY-like 5
sheep(101108139) TSPY-like 5
135 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_033512 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_033512 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_033512 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001085421 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001085421 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001085421 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU046361 MISSION® esiRNA esiRNA human TSPYL5 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_033512 Rosetta Predictions human pricing
XM_001057731 Rosetta Predictions rat pricing
XM_234776 Rosetta Predictions rat pricing
NM_001085421 Rosetta Predictions mouse pricing
XM_139378 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_033512 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00104314 predicted 1595
2 SASI_Hs02_00361394 predicted 1482
3 SASI_Hs01_00104315 predicted 883
4 SASI_Hs01_00104316 predicted 1137
5 SASI_Hs02_00361395 predicted 1340
6 SASI_Hs01_00104318 predicted 1578
7 SASI_Hs01_00104319 predicted 1028
8 SASI_Hs01_00104320 predicted 1465
9 SASI_Hs02_00361396 predicted 1479
10 SASI_Hs01_00104321 predicted 882
11 SASI_Hs01_00104313 predicted 1183
12 SASI_Hs01_00104317 predicted 1572
13 SASI_Hs01_00104322 predicted 785
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001057731 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00287386 predicted 1214
2 SASI_Rn02_00287387 predicted 839
3 SASI_Rn02_00287388 predicted 1206
4 SASI_Rn02_00287389 predicted 1371
5 SASI_Rn02_00287390 predicted 1402
6 SASI_Rn02_00287391 predicted 1447
7 SASI_Rn02_00287392 predicted 1386
8 SASI_Rn02_00287393 predicted 934
9 SASI_Rn02_00287394 predicted 631
10 SASI_Rn02_00287395 predicted 814
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_234776 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00388684 predicted 1534
2 SASI_Rn02_00388685 predicted 1541
3 SASI_Rn02_00388686 predicted 1508
4 SASI_Rn02_00388687 predicted 1499
5 SASI_Rn02_00388688 predicted 1490
6 SASI_Rn02_00388689 predicted 1553
7 SASI_Rn02_00388690 predicted 1560
8 SASI_Rn02_00388691 predicted 1561
9 SASI_Rn02_00388692 predicted 1582
10 SASI_Rn02_00388693 predicted 1577
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001085421 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00300422 predicted 1154
2 SASI_Mm02_00300423 predicted 1151
3 SASI_Mm02_00300424 predicted 992
4 SASI_Mm02_00300425 predicted 551
5 SASI_Mm02_00300426 predicted 866
6 SASI_Mm02_00300427 predicted 746
7 SASI_Mm02_00300428 predicted 702
8 SASI_Mm02_00300429 predicted 993
9 SASI_Mm02_00300430 predicted 1061
10 SASI_Mm02_00300431 predicted 1104
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_139378 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00223807 predicted 1119
2 SASI_Mm01_00223808 predicted 1115
3 SASI_Mm01_00223809 predicted 1102
4 SASI_Mm01_00223810 predicted 958
5 SASI_Mm01_00223811 predicted 518
6 SASI_Mm01_00223812 predicted 845
7 SASI_Mm01_00223813 predicted 723
8 SASI_Mm01_00223814 predicted 670
9 SASI_Mm01_00223815 predicted 971
10 SASI_Mm01_00223816 predicted 1041
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_033512
VALIDATED
TSPYL5 MISSION shRNA Bacterial Glycerol Stock
TSPY-like 5
Human
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000322652    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 2 Clone ID:NM_033512.2-1814s21c1
Sequence:CCGGAGCCAGTGCACATGGTATTAGCTCGAGCTAATACCATGTGCACTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000322580    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 2 Clone ID:NM_033512.2-1070s21c1
Sequence:CCGGGTCTCGTTCTACTCCAATCCACTCGAGTGGATTGGAGTAGAACGAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000322582    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 2 Clone ID:NM_033512.2-995s21c1
Sequence:CCGGCTTCGATCGCAACCCGTATTTCTCGAGAAATACGGGTTGCGATCGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000322584    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 2 Clone ID:NM_033512.2-917s21c1
Sequence:CCGGAGAGGTACTGAGCTACTTAAACTCGAGTTTAAGTAGCTCAGTACCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000322581    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 2 Clone ID:NM_033512.2-1226s21c1
Sequence:CCGGGCCCAATCCCTTGCAGTTCTACTCGAGTAGAACTGCAAGGGATTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000144381    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033512.1-896s1c1
Sequence:CCGGCTTTCTGAATAGCCAAGAGAACTCGAGTTCTCTTGGCTATTCAGAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000140740    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_033512.1-731s1c1
Sequence:CCGGGCTGAAGCTGGAGAACATGAACTCGAGTTCATGTTCTCCAGCTTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000139099    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033512.1-884s1c1
Sequence:CCGGCCAGCTAGCATCCTTTCTGAACTCGAGTTCAGAAAGGATGCTAGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000139912    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_033512.1-999s1c1
Sequence:CCGGGATCGCAACCCGTATTTCCAACTCGAGTTGGAAATACGGGTTGCGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000139944    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033512.1-1070s1c1
Sequence:CCGGGTCTCGTTCTACTCCAATCCACTCGAGTGGATTGGAGTAGAACGAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000122858    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033512.1-1226s1c1
Sequence:CCGGGCCCAATCCCTTGCAGTTCTACTCGAGTAGAACTGCAAGGGATTGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000122783    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_033512.1-737s1c1
Sequence:CCGGGCTGGAGAACATGAACGCCCACTCGAGTGGGCGTTCATGTTCTCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000122720    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033512.1-211s1c1
Sequence:CCGGCGGACCCTTCACAGTACCAGACTCGAGTCTGGTACTGTGAAGGGTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_033512
VALIDATED
TSPYL5 MISSION shRNA shRNA Plasmid DNA
TSPY-like 5
Human
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000322652    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 2 Clone ID:NM_033512.2-1814s21c1
Sequence:CCGGAGCCAGTGCACATGGTATTAGCTCGAGCTAATACCATGTGCACTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000322580    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 2 Clone ID:NM_033512.2-1070s21c1
Sequence:CCGGGTCTCGTTCTACTCCAATCCACTCGAGTGGATTGGAGTAGAACGAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000322582    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 2 Clone ID:NM_033512.2-995s21c1
Sequence:CCGGCTTCGATCGCAACCCGTATTTCTCGAGAAATACGGGTTGCGATCGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000322584    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 2 Clone ID:NM_033512.2-917s21c1
Sequence:CCGGAGAGGTACTGAGCTACTTAAACTCGAGTTTAAGTAGCTCAGTACCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000322581    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 2 Clone ID:NM_033512.2-1226s21c1
Sequence:CCGGGCCCAATCCCTTGCAGTTCTACTCGAGTAGAACTGCAAGGGATTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000144381    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033512.1-896s1c1
Sequence:CCGGCTTTCTGAATAGCCAAGAGAACTCGAGTTCTCTTGGCTATTCAGAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000140740    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_033512.1-731s1c1
Sequence:CCGGGCTGAAGCTGGAGAACATGAACTCGAGTTCATGTTCTCCAGCTTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000139099    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033512.1-884s1c1
Sequence:CCGGCCAGCTAGCATCCTTTCTGAACTCGAGTTCAGAAAGGATGCTAGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000139912    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_033512.1-999s1c1
Sequence:CCGGGATCGCAACCCGTATTTCCAACTCGAGTTGGAAATACGGGTTGCGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000139944    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033512.1-1070s1c1
Sequence:CCGGGTCTCGTTCTACTCCAATCCACTCGAGTGGATTGGAGTAGAACGAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000122858    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033512.1-1226s1c1
Sequence:CCGGGCCCAATCCCTTGCAGTTCTACTCGAGTAGAACTGCAAGGGATTGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000122783    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_033512.1-737s1c1
Sequence:CCGGGCTGGAGAACATGAACGCCCACTCGAGTGGGCGTTCATGTTCTCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000122720    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033512.1-211s1c1
Sequence:CCGGCGGACCCTTCACAGTACCAGACTCGAGTCTGGTACTGTGAAGGGTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_033512
VALIDATED
TSPYL5 MISSION shRNA Lentiviral Transduction Particles
TSPY-like 5
Human
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000322652    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 2 Clone ID:NM_033512.2-1814s21c1
Sequence:CCGGAGCCAGTGCACATGGTATTAGCTCGAGCTAATACCATGTGCACTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000322580    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 2 Clone ID:NM_033512.2-1070s21c1
Sequence:CCGGGTCTCGTTCTACTCCAATCCACTCGAGTGGATTGGAGTAGAACGAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000322582    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 2 Clone ID:NM_033512.2-995s21c1
Sequence:CCGGCTTCGATCGCAACCCGTATTTCTCGAGAAATACGGGTTGCGATCGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000322584    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 2 Clone ID:NM_033512.2-917s21c1
Sequence:CCGGAGAGGTACTGAGCTACTTAAACTCGAGTTTAAGTAGCTCAGTACCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000322581    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 2 Clone ID:NM_033512.2-1226s21c1
Sequence:CCGGGCCCAATCCCTTGCAGTTCTACTCGAGTAGAACTGCAAGGGATTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000144381    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033512.1-896s1c1
Sequence:CCGGCTTTCTGAATAGCCAAGAGAACTCGAGTTCTCTTGGCTATTCAGAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000140740    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_033512.1-731s1c1
Sequence:CCGGGCTGAAGCTGGAGAACATGAACTCGAGTTCATGTTCTCCAGCTTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000139099    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033512.1-884s1c1
Sequence:CCGGCCAGCTAGCATCCTTTCTGAACTCGAGTTCAGAAAGGATGCTAGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000139912    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_033512.1-999s1c1
Sequence:CCGGGATCGCAACCCGTATTTCCAACTCGAGTTGGAAATACGGGTTGCGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000139944    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033512.1-1070s1c1
Sequence:CCGGGTCTCGTTCTACTCCAATCCACTCGAGTGGATTGGAGTAGAACGAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000122858    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033512.1-1226s1c1
Sequence:CCGGGCCCAATCCCTTGCAGTTCTACTCGAGTAGAACTGCAAGGGATTGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000122783    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_033512.1-737s1c1
Sequence:CCGGGCTGGAGAACATGAACGCCCACTCGAGTGGGCGTTCATGTTCTCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000122720    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033512.1-211s1c1
Sequence:CCGGCGGACCCTTCACAGTACCAGACTCGAGTCTGGTACTGTGAAGGGTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001085421
TSPYL5 MISSION shRNA Bacterial Glycerol Stock
TSPY-like 5
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000238777    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001085421.1-1952s21c1
Sequence:CCGGTTGGCTAGGTGGGTGTTATTGCTCGAGCAATAACACCCACCTAGCCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000239265    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001085421.1-739s21c1
Sequence:CCGGTCAGGCTTTCACGCAAGTTTGCTCGAGCAAACTTGCGTGAAAGCCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000239264    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001085421.1-763s21c1
Sequence:CCGGAGTTGCGACTTCACCACTTAGCTCGAGCTAAGTGGTGAAGTCGCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000239263    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001085421.1-1155s21c1
Sequence:CCGGGACAAGATTGTTGAGATAATTCTCGAGAATTATCTCAACAATCTTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000239262    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001085421.1-878s21c1
Sequence:CCGGTAAGGAGGTATTGAGCTATTTCTCGAGAAATAGCTCAATACCTCCTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001085421
TSPYL5 MISSION shRNA shRNA Plasmid DNA
TSPY-like 5
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000238777    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001085421.1-1952s21c1
Sequence:CCGGTTGGCTAGGTGGGTGTTATTGCTCGAGCAATAACACCCACCTAGCCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000239265    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001085421.1-739s21c1
Sequence:CCGGTCAGGCTTTCACGCAAGTTTGCTCGAGCAAACTTGCGTGAAAGCCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000239264    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001085421.1-763s21c1
Sequence:CCGGAGTTGCGACTTCACCACTTAGCTCGAGCTAAGTGGTGAAGTCGCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000239263    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001085421.1-1155s21c1
Sequence:CCGGGACAAGATTGTTGAGATAATTCTCGAGAATTATCTCAACAATCTTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000239262    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001085421.1-878s21c1
Sequence:CCGGTAAGGAGGTATTGAGCTATTTCTCGAGAAATAGCTCAATACCTCCTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001085421
TSPYL5 MISSION shRNA Lentiviral Transduction Particles
TSPY-like 5
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000238777    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001085421.1-1952s21c1
Sequence:CCGGTTGGCTAGGTGGGTGTTATTGCTCGAGCAATAACACCCACCTAGCCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000239265    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001085421.1-739s21c1
Sequence:CCGGTCAGGCTTTCACGCAAGTTTGCTCGAGCAAACTTGCGTGAAAGCCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000239264    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001085421.1-763s21c1
Sequence:CCGGAGTTGCGACTTCACCACTTAGCTCGAGCTAAGTGGTGAAGTCGCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000239263    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001085421.1-1155s21c1
Sequence:CCGGGACAAGATTGTTGAGATAATTCTCGAGAATTATCTCAACAATCTTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000239262    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001085421.1-878s21c1
Sequence:CCGGTAAGGAGGTATTGAGCTATTTCTCGAGAAATAGCTCAATACCTCCTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks