EMAIL THIS PAGE TO A FRIEND

TSPYL6

TSPY-like 6

Species: Human TSPYL6(388951), domestic cat TSPYL6(101095816)
UniProtKB ID: Q8N831, Q6NUJ3
Gene ID:
65 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001003937 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001003937 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001003937 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU138121 MISSION® esiRNA esiRNA human TSPYL6 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001003937 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001003937 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00114746 predicted 1013
2 SASI_Hs01_00114747 predicted 1418
3 SASI_Hs01_00114748 predicted 1356
4 SASI_Hs01_00114749 predicted 939
5 SASI_Hs02_00304425 predicted 217
6 SASI_Hs02_00304426 predicted 834
7 SASI_Hs01_00114751 predicted 350
8 SASI_Hs01_00114752 predicted 1202
9 SASI_Hs01_00114753 predicted 650
10 SASI_Hs02_00304427 predicted 216
11 SASI_Hs01_00114750 predicted 1284
12 SASI_Hs01_00114754 predicted 1284
13 SASI_Hs01_00114755 predicted 882
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001003937
TSPYL6 MISSION shRNA Bacterial Glycerol Stock
TSPY-like 6
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000137867    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001003937.1-1268s1c1
Sequence:CCGGCTTTGGGTTCCAGTGTGGTTACTCGAGTAACCACACTGGAACCCAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000137586    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001003937.1-151s1c1
Sequence:CCGGCGACAGAGGTAATGGCAGATACTCGAGTATCTGCCATTACCTCTGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000136238    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001003937.1-867s1c1
Sequence:CCGGGCCGAGATGTTAAGCTACTTACTCGAGTAAGTAGCTTAACATCTCGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000135438    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001003937.1-152s1c1
Sequence:CCGGGACAGAGGTAATGGCAGATATCTCGAGATATCTGCCATTACCTCTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000134406    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001003937.1-2736s1c1
Sequence:CCGGGCCTTACTTATGTGGAAGATTCTCGAGAATCTTCCACATAAGTAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000134888    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001003937.1-868s1c1
Sequence:CCGGCCGAGATGTTAAGCTACTTAACTCGAGTTAAGTAGCTTAACATCTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000135167    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001003937.1-959s1c1
Sequence:CCGGCCCTTACTTCAGAAACAAGCTCTCGAGAGCTTGTTTCTGAAGTAAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000136079    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001003937.1-2568s1c1
Sequence:CCGGGCCTAGAATTTACACTGGGTTCTCGAGAACCCAGTGTAAATTCTAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000137641    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001003937.1-2362s1c1
Sequence:CCGGCCAGACCTCTTATTGCCCATTCTCGAGAATGGGCAATAAGAGGTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001003937
TSPYL6 MISSION shRNA shRNA Plasmid DNA
TSPY-like 6
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000137867    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001003937.1-1268s1c1
Sequence:CCGGCTTTGGGTTCCAGTGTGGTTACTCGAGTAACCACACTGGAACCCAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000137586    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001003937.1-151s1c1
Sequence:CCGGCGACAGAGGTAATGGCAGATACTCGAGTATCTGCCATTACCTCTGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000136238    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001003937.1-867s1c1
Sequence:CCGGGCCGAGATGTTAAGCTACTTACTCGAGTAAGTAGCTTAACATCTCGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000135438    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001003937.1-152s1c1
Sequence:CCGGGACAGAGGTAATGGCAGATATCTCGAGATATCTGCCATTACCTCTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000134406    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001003937.1-2736s1c1
Sequence:CCGGGCCTTACTTATGTGGAAGATTCTCGAGAATCTTCCACATAAGTAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000134888    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001003937.1-868s1c1
Sequence:CCGGCCGAGATGTTAAGCTACTTAACTCGAGTTAAGTAGCTTAACATCTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000135167    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001003937.1-959s1c1
Sequence:CCGGCCCTTACTTCAGAAACAAGCTCTCGAGAGCTTGTTTCTGAAGTAAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000136079    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001003937.1-2568s1c1
Sequence:CCGGGCCTAGAATTTACACTGGGTTCTCGAGAACCCAGTGTAAATTCTAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000137641    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001003937.1-2362s1c1
Sequence:CCGGCCAGACCTCTTATTGCCCATTCTCGAGAATGGGCAATAAGAGGTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001003937
TSPYL6 MISSION shRNA Lentiviral Transduction Particles
TSPY-like 6
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000137867    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001003937.1-1268s1c1
Sequence:CCGGCTTTGGGTTCCAGTGTGGTTACTCGAGTAACCACACTGGAACCCAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000137586    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001003937.1-151s1c1
Sequence:CCGGCGACAGAGGTAATGGCAGATACTCGAGTATCTGCCATTACCTCTGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000136238    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001003937.1-867s1c1
Sequence:CCGGGCCGAGATGTTAAGCTACTTACTCGAGTAAGTAGCTTAACATCTCGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000135438    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001003937.1-152s1c1
Sequence:CCGGGACAGAGGTAATGGCAGATATCTCGAGATATCTGCCATTACCTCTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000134406    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001003937.1-2736s1c1
Sequence:CCGGGCCTTACTTATGTGGAAGATTCTCGAGAATCTTCCACATAAGTAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000134888    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001003937.1-868s1c1
Sequence:CCGGCCGAGATGTTAAGCTACTTAACTCGAGTTAAGTAGCTTAACATCTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000135167    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001003937.1-959s1c1
Sequence:CCGGCCCTTACTTCAGAAACAAGCTCTCGAGAGCTTGTTTCTGAAGTAAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000136079    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001003937.1-2568s1c1
Sequence:CCGGGCCTAGAATTTACACTGGGTTCTCGAGAACCCAGTGTAAATTCTAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000137641    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001003937.1-2362s1c1
Sequence:CCGGCCAGACCTCTTATTGCCCATTCTCGAGAATGGGCAATAAGAGGTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks