EMAIL THIS PAGE TO A FRIEND

TSR1

TSR1, 20S rRNA accumulation, homolog (S. cerevisiae)

UniProtKB ID: Q2NL82, Q8WUY5, Q9NVT0, Q9P2E6
Gene ID:
Mouse(104662) TSR1 20S rRNA accumulation
Rat(100360406) TSR1, 20S rRNA accumulation, homolog (S. cerevisiae)
Zebrafish(325037) TSR1, 20S rRNA accumulation, homolog (yeast)
domestic cat(101098665) TSR1, 20S rRNA accumulation, homolog (S. cerevisiae)
Horse(100060250) TSR1, 20S rRNA accumulation, homolog (S. cerevisiae)
dog(491201) TSR1, 20S rRNA accumulation, homolog (S. cerevisiae)
chicken(417565) TSR1, 20S rRNA accumulation, homolog (S. cerevisiae)
domestic guinea pig(100715132) TSR1, 20S rRNA accumulation, homolog (S. cerevisiae)
naked mole-rat(101700596) TSR1, 20S rRNA accumulation, homolog (S. cerevisiae)
cow(510820) TSR1, 20S rRNA accumulation, homolog (S. cerevisiae)
sheep(101118457) TSR1, 20S rRNA accumulation, homolog (S. cerevisiae)
69 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_018128 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_018128 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_018128 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_177325 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_177325 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_177325 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_018128 Rosetta Predictions human pricing
NM_177325 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018128 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00017564 predicted 1559
2 SASI_Hs01_00017565 predicted 2025
3 SASI_Hs01_00017566 predicted 2781
4 SASI_Hs01_00017567 predicted 2916
5 SASI_Hs01_00017568 predicted 1703
6 SASI_Hs01_00017569 predicted 1932
7 SASI_Hs01_00017570 predicted 3170
8 SASI_Hs01_00017571 predicted 2216
9 SASI_Hs01_00017572 predicted 2248
10 SASI_Hs01_00017573 predicted 1391
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_177325 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00053252 predicted 962
2 SASI_Mm01_00053253 predicted 784
3 SASI_Mm01_00053254 predicted 834
4 SASI_Mm01_00053256 predicted 1712
5 SASI_Mm02_00347418 predicted 468
6 SASI_Mm02_00347419 predicted 483
7 SASI_Mm01_00053257 predicted 1596
8 SASI_Mm02_00347420 predicted 328
9 SASI_Mm01_00053259 predicted 876
10 SASI_Mm02_00347421 predicted 414
11 SASI_Mm01_00053255 predicted 1413
12 SASI_Mm01_00053258 predicted 1582
13 SASI_Mm01_00053260 predicted 937
14 SASI_Mm01_00053261 predicted 1033
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018128
TSR1 MISSION shRNA Bacterial Glycerol Stock
TSR1, 20S rRNA accumulation, homolog (S. cerevisiae)
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000168326    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018128.4-1575s1c1
Sequence:CCGGGCTAAGTAAAGCAGTGGAGAACTCGAGTTCTCCACTGCTTTACTTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000167001    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018128.4-2550s1c1
Sequence:CCGGGAACTTTACTAACACTAGGAACTCGAGTTCCTAGTGTTAGTAAAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000166881    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_018128.4-3967s1c1
Sequence:CCGGCCTATAAAGTTCAGATGAGAACTCGAGTTCTCATCTGAACTTTATAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000166981    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018128.4-2861s1c1
Sequence:CCGGCGGACAAACATAAATTGCAGACTCGAGTCTGCAATTTATGTTTGTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000168143    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018128.4-1946s1c1
Sequence:CCGGCTACGGATGCTGTAGATGATACTCGAGTATCATCTACAGCATCCGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000167469    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018128.4-2319s1c1
Sequence:CCGGGCATGATGATCTGTATGATAACTCGAGTTATCATACAGATCATCATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000167963    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018128.4-1074s1c1
Sequence:CCGGCCTAAGCAAGAAGGTGAGAAACTCGAGTTTCTCACCTTCTTGCTTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000232830    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018128.4-1827s21c1
Sequence:CCGGTATCGTTGGATATGGTGATTTCTCGAGAAATCACCATATCCAACGATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000232832    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018128.4-2520s21c1
Sequence:CCGGTCAAGATTATGCTCGAATATTCTCGAGAATATTCGAGCATAATCTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000232834    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018128.4-3954s21c1
Sequence:CCGGTCTAGTTGGTTTACCTATAAACTCGAGTTTATAGGTAAACCAACTAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000232833    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018128.4-2785s21c1
Sequence:CCGGGCCAAGGAAGAGCTCATATTTCTCGAGAAATATGAGCTCTTCCTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000232831    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018128.4-1962s21c1
Sequence:CCGGTGATATGGAAGAAGGTCTTAACTCGAGTTAAGACCTTCTTCCATATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018128
TSR1 MISSION shRNA shRNA Plasmid DNA
TSR1, 20S rRNA accumulation, homolog (S. cerevisiae)
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000168326    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018128.4-1575s1c1
Sequence:CCGGGCTAAGTAAAGCAGTGGAGAACTCGAGTTCTCCACTGCTTTACTTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000167001    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018128.4-2550s1c1
Sequence:CCGGGAACTTTACTAACACTAGGAACTCGAGTTCCTAGTGTTAGTAAAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000166881    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_018128.4-3967s1c1
Sequence:CCGGCCTATAAAGTTCAGATGAGAACTCGAGTTCTCATCTGAACTTTATAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000166981    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018128.4-2861s1c1
Sequence:CCGGCGGACAAACATAAATTGCAGACTCGAGTCTGCAATTTATGTTTGTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000168143    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018128.4-1946s1c1
Sequence:CCGGCTACGGATGCTGTAGATGATACTCGAGTATCATCTACAGCATCCGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000167469    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018128.4-2319s1c1
Sequence:CCGGGCATGATGATCTGTATGATAACTCGAGTTATCATACAGATCATCATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000167963    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018128.4-1074s1c1
Sequence:CCGGCCTAAGCAAGAAGGTGAGAAACTCGAGTTTCTCACCTTCTTGCTTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000232830    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018128.4-1827s21c1
Sequence:CCGGTATCGTTGGATATGGTGATTTCTCGAGAAATCACCATATCCAACGATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000232832    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018128.4-2520s21c1
Sequence:CCGGTCAAGATTATGCTCGAATATTCTCGAGAATATTCGAGCATAATCTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000232834    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018128.4-3954s21c1
Sequence:CCGGTCTAGTTGGTTTACCTATAAACTCGAGTTTATAGGTAAACCAACTAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000232833    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018128.4-2785s21c1
Sequence:CCGGGCCAAGGAAGAGCTCATATTTCTCGAGAAATATGAGCTCTTCCTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000232831    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018128.4-1962s21c1
Sequence:CCGGTGATATGGAAGAAGGTCTTAACTCGAGTTAAGACCTTCTTCCATATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018128
TSR1 MISSION shRNA Lentiviral Transduction Particles
TSR1, 20S rRNA accumulation, homolog (S. cerevisiae)
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000168326    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018128.4-1575s1c1
Sequence:CCGGGCTAAGTAAAGCAGTGGAGAACTCGAGTTCTCCACTGCTTTACTTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000167001    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018128.4-2550s1c1
Sequence:CCGGGAACTTTACTAACACTAGGAACTCGAGTTCCTAGTGTTAGTAAAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000166881    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_018128.4-3967s1c1
Sequence:CCGGCCTATAAAGTTCAGATGAGAACTCGAGTTCTCATCTGAACTTTATAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000166981    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018128.4-2861s1c1
Sequence:CCGGCGGACAAACATAAATTGCAGACTCGAGTCTGCAATTTATGTTTGTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000168143    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018128.4-1946s1c1
Sequence:CCGGCTACGGATGCTGTAGATGATACTCGAGTATCATCTACAGCATCCGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000167469    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018128.4-2319s1c1
Sequence:CCGGGCATGATGATCTGTATGATAACTCGAGTTATCATACAGATCATCATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000167963    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018128.4-1074s1c1
Sequence:CCGGCCTAAGCAAGAAGGTGAGAAACTCGAGTTTCTCACCTTCTTGCTTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000232830    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018128.4-1827s21c1
Sequence:CCGGTATCGTTGGATATGGTGATTTCTCGAGAAATCACCATATCCAACGATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000232832    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018128.4-2520s21c1
Sequence:CCGGTCAAGATTATGCTCGAATATTCTCGAGAATATTCGAGCATAATCTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000232834    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018128.4-3954s21c1
Sequence:CCGGTCTAGTTGGTTTACCTATAAACTCGAGTTTATAGGTAAACCAACTAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000232833    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018128.4-2785s21c1
Sequence:CCGGGCCAAGGAAGAGCTCATATTTCTCGAGAAATATGAGCTCTTCCTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000232831    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018128.4-1962s21c1
Sequence:CCGGTGATATGGAAGAAGGTCTTAACTCGAGTTAAGACCTTCTTCCATATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_177325
VALIDATED
TSR1 MISSION shRNA Bacterial Glycerol Stock
TSR1, 20S rRNA accumulation, homolog (S. cerevisiae)
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000179212    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177325.2-619s1c1
Sequence:CCGGGCCCGAAAGAAGCTAAGTAAACTCGAGTTTACTTAGCTTCTTTCGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000196152    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177325.2-1216s1c1
Sequence:CCGGGCTGAGTGGATTCTGGATGAACTCGAGTTCATCCAGAATCCACTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000257962    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_177325.3-646s21c1
Sequence:CCGGGCCCGAAAGAAGCTAAGTAAACTCGAGTTTACTTAGCTTCTTTCGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000249806    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_177325.3-909s21c1
Sequence:CCGGTATCGTTGGACACGGTGATTTCTCGAGAAATCACCGTGTCCAACGATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000249805    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_177325.3-1599s21c1
Sequence:CCGGTAGAGATTATGCTCGGATATTCTCGAGAATATCCGAGCATAATCTCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000217919    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177325.3-1735s1c1
Sequence:CCGGGTCTCAGTGGTTGAGTATTTCCTCGAGGAAATACTCAACCACTGAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000249803    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.5 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_177325.3-2937s21c1
Sequence:CCGGGGAGTCTAGTAGGTTACATTCCTCGAGGAATGTAACCTACTAGACTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000249804    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_177325.3-1392s21c1
Sequence:CCGGGTCTGTGCGTGACGATCTATACTCGAGTATAGATCGTCACGCACAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_177325
VALIDATED
TSR1 MISSION shRNA shRNA Plasmid DNA
TSR1, 20S rRNA accumulation, homolog (S. cerevisiae)
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000179212    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177325.2-619s1c1
Sequence:CCGGGCCCGAAAGAAGCTAAGTAAACTCGAGTTTACTTAGCTTCTTTCGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000196152    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177325.2-1216s1c1
Sequence:CCGGGCTGAGTGGATTCTGGATGAACTCGAGTTCATCCAGAATCCACTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000257962    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_177325.3-646s21c1
Sequence:CCGGGCCCGAAAGAAGCTAAGTAAACTCGAGTTTACTTAGCTTCTTTCGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000249806    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_177325.3-909s21c1
Sequence:CCGGTATCGTTGGACACGGTGATTTCTCGAGAAATCACCGTGTCCAACGATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000249805    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_177325.3-1599s21c1
Sequence:CCGGTAGAGATTATGCTCGGATATTCTCGAGAATATCCGAGCATAATCTCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000217919    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177325.3-1735s1c1
Sequence:CCGGGTCTCAGTGGTTGAGTATTTCCTCGAGGAAATACTCAACCACTGAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000249803    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.5 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_177325.3-2937s21c1
Sequence:CCGGGGAGTCTAGTAGGTTACATTCCTCGAGGAATGTAACCTACTAGACTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000249804    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_177325.3-1392s21c1
Sequence:CCGGGTCTGTGCGTGACGATCTATACTCGAGTATAGATCGTCACGCACAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_177325
VALIDATED
TSR1 MISSION shRNA Lentiviral Transduction Particles
TSR1, 20S rRNA accumulation, homolog (S. cerevisiae)
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000179212    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177325.2-619s1c1
Sequence:CCGGGCCCGAAAGAAGCTAAGTAAACTCGAGTTTACTTAGCTTCTTTCGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000196152    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177325.2-1216s1c1
Sequence:CCGGGCTGAGTGGATTCTGGATGAACTCGAGTTCATCCAGAATCCACTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000257962    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_177325.3-646s21c1
Sequence:CCGGGCCCGAAAGAAGCTAAGTAAACTCGAGTTTACTTAGCTTCTTTCGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000249806    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_177325.3-909s21c1
Sequence:CCGGTATCGTTGGACACGGTGATTTCTCGAGAAATCACCGTGTCCAACGATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000249805    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_177325.3-1599s21c1
Sequence:CCGGTAGAGATTATGCTCGGATATTCTCGAGAATATCCGAGCATAATCTCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000217919    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177325.3-1735s1c1
Sequence:CCGGGTCTCAGTGGTTGAGTATTTCCTCGAGGAAATACTCAACCACTGAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000249803    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.5 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_177325.3-2937s21c1
Sequence:CCGGGGAGTCTAGTAGGTTACATTCCTCGAGGAATGTAACCTACTAGACTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000249804    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_177325.3-1392s21c1
Sequence:CCGGGTCTGTGCGTGACGATCTATACTCGAGTATAGATCGTCACGCACAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks