EMAIL THIS PAGE TO A FRIEND

TSR2

TSR2, 20S rRNA accumulation, homolog (S. cerevisiae)

Synonyms: DT1P1A10 WGG1
UniProtKB ID: Q969E8
Gene ID:
Mouse(69499) TSR2 20S rRNA accumulation
Rat(317418) TSR2, 20S rRNA accumulation, homolog (S. cerevisiae)
cow(511210) TSR2, 20S rRNA accumulation, homolog (S. cerevisiae)
sheep(101117304) TSR2, 20S rRNA accumulation, homolog (S. cerevisiae)
naked mole-rat(101720453) TSR2, 20S rRNA accumulation, homolog (S. cerevisiae)
domestic guinea pig(100719557) TSR2, 20S rRNA accumulation, homolog (S. cerevisiae)
Zebrafish(317639) TSR2, 20S rRNA accumulation, homolog (S. cerevisiae)
dog(480932) TSR2, 20S rRNA accumulation, homolog (S. cerevisiae)
domestic cat(101093249) TSR2, 20S rRNA accumulation, homolog (S. cerevisiae)
58 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_058163 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_058163 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_058163 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_175146 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_175146 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_175146 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_058163 Rosetta Predictions human pricing
NM_001115027 Rosetta Predictions rat pricing
XM_228869 Rosetta Predictions rat pricing
NM_175146 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_058163 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00092119 predicted 320
2 SASI_Hs01_00092120 predicted 203
3 SASI_Hs01_00092121 predicted 384
4 SASI_Hs01_00092122 predicted 223
5 SASI_Hs02_00362064 predicted 1011
6 SASI_Hs01_00092123 predicted 278
7 SASI_Hs02_00362065 predicted 1040
8 SASI_Hs01_00092124 predicted 213
9 SASI_Hs01_00092125 predicted 378
10 SASI_Hs01_00092126 predicted 384
11 SASI_Hs01_00092117 predicted 228
12 SASI_Hs01_00092118 predicted 984
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001115027 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00252443 predicted 609
2 SASI_Rn02_00252444 predicted 340
3 SASI_Rn02_00252445 predicted 684
4 SASI_Rn02_00252446 predicted 544
5 SASI_Rn02_00252447 predicted 500
6 SASI_Rn02_00252448 predicted 989
7 SASI_Rn02_00252449 predicted 863
8 SASI_Rn02_00252450 predicted 295
9 SASI_Rn02_00252451 predicted 834
10 SASI_Rn02_00252452 predicted 626
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_228869 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00136415 predicted 622
2 SASI_Rn01_00136416 predicted 350
3 SASI_Rn01_00136417 predicted 694
4 SASI_Rn01_00136418 predicted 543
5 SASI_Rn01_00136419 predicted 987
6 SASI_Rn01_00136420 predicted 869
7 SASI_Rn01_00136421 predicted 301
8 SASI_Rn01_00136422 predicted 458
9 SASI_Rn01_00136423 predicted 843
10 SASI_Rn01_00136424 predicted 637
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_175146 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00147392 predicted 915
2 SASI_Mm01_00147393 predicted 1067
3 SASI_Mm01_00147394 predicted 806
4 SASI_Mm01_00147395 predicted 213
5 SASI_Mm01_00147397 predicted 287
6 SASI_Mm01_00147398 predicted 529
7 SASI_Mm01_00147399 predicted 488
8 SASI_Mm01_00147400 predicted 828
9 SASI_Mm01_00147401 predicted 513
10 SASI_Mm02_00345785 predicted 531
11 SASI_Mm01_00147396 predicted 333
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_058163
VALIDATED
TSR2 MISSION shRNA Bacterial Glycerol Stock
TSR2, 20S rRNA accumulation, homolog (S. cerevisiae)
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000353038    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_058163.1-595s21c1
Sequence:CCGGATGGCTTTGGGCCCTTATTTGCTCGAGCAAATAAGGGCCCAAAGCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000344160    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_058163.1-214s21c1
Sequence:CCGGAGCTGTTGACCAACGAGTTTGCTCGAGCAAACTCGTTGGTCAACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000344161    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_058163.1-439s21c1
Sequence:CCGGTGGAGGTCACAGCTACGAATGCTCGAGCATTCGTAGCTGTGACCTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000344159    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_058163.1-512s21c1
Sequence:CCGGCGCTCAGACTATTAAGGAAGACTCGAGTCTTCCTTAATAGTCTGAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000344162    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_058163.1-154s21c1
Sequence:CCGGAGGATTACTTCATGCGCAATGCTCGAGCATTGCGCATGAAGTAATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000172534    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_058163.1-213s1c1
Sequence:CCGGGAGCTGTTGACCAACGAGTTTCTCGAGAAACTCGTTGGTCAACAGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000168800    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_058163.1-156s1c1
Sequence:CCGGGATTACTTCATGCGCAATGCTCTCGAGAGCATTGCGCATGAAGTAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000172642    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_058163.1-441s1c1
Sequence:CCGGGAGGTCACAGCTACGAATGATCTCGAGATCATTCGTAGCTGTGACCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000168506    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_058163.1-999s1c1
Sequence:CCGGGAGATGAACATGCAAGTGGAACTCGAGTTCCACTTGCATGTTCATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000168306    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_058163.1-153s1c1
Sequence:CCGGGAGGATTACTTCATGCGCAATCTCGAGATTGCGCATGAAGTAATCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000167951    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_058163.1-512s1c1
Sequence:CCGGCGCTCAGACTATTAAGGAAGACTCGAGTCTTCCTTAATAGTCTGAGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000168263    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_058163.1-216s1c1
Sequence:CCGGCTGTTGACCAACGAGTTTGATCTCGAGATCAAACTCGTTGGTCAACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_058163
VALIDATED
TSR2 MISSION shRNA shRNA Plasmid DNA
TSR2, 20S rRNA accumulation, homolog (S. cerevisiae)
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000353038    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_058163.1-595s21c1
Sequence:CCGGATGGCTTTGGGCCCTTATTTGCTCGAGCAAATAAGGGCCCAAAGCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000344160    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_058163.1-214s21c1
Sequence:CCGGAGCTGTTGACCAACGAGTTTGCTCGAGCAAACTCGTTGGTCAACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000344161    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_058163.1-439s21c1
Sequence:CCGGTGGAGGTCACAGCTACGAATGCTCGAGCATTCGTAGCTGTGACCTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000344159    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_058163.1-512s21c1
Sequence:CCGGCGCTCAGACTATTAAGGAAGACTCGAGTCTTCCTTAATAGTCTGAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000344162    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_058163.1-154s21c1
Sequence:CCGGAGGATTACTTCATGCGCAATGCTCGAGCATTGCGCATGAAGTAATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000172534    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_058163.1-213s1c1
Sequence:CCGGGAGCTGTTGACCAACGAGTTTCTCGAGAAACTCGTTGGTCAACAGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000168800    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_058163.1-156s1c1
Sequence:CCGGGATTACTTCATGCGCAATGCTCTCGAGAGCATTGCGCATGAAGTAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000172642    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_058163.1-441s1c1
Sequence:CCGGGAGGTCACAGCTACGAATGATCTCGAGATCATTCGTAGCTGTGACCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000168506    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_058163.1-999s1c1
Sequence:CCGGGAGATGAACATGCAAGTGGAACTCGAGTTCCACTTGCATGTTCATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000168306    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_058163.1-153s1c1
Sequence:CCGGGAGGATTACTTCATGCGCAATCTCGAGATTGCGCATGAAGTAATCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000167951    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_058163.1-512s1c1
Sequence:CCGGCGCTCAGACTATTAAGGAAGACTCGAGTCTTCCTTAATAGTCTGAGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000168263    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_058163.1-216s1c1
Sequence:CCGGCTGTTGACCAACGAGTTTGATCTCGAGATCAAACTCGTTGGTCAACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_058163
VALIDATED
TSR2 MISSION shRNA Lentiviral Transduction Particles
TSR2, 20S rRNA accumulation, homolog (S. cerevisiae)
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000353038    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_058163.1-595s21c1
Sequence:CCGGATGGCTTTGGGCCCTTATTTGCTCGAGCAAATAAGGGCCCAAAGCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000344160    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_058163.1-214s21c1
Sequence:CCGGAGCTGTTGACCAACGAGTTTGCTCGAGCAAACTCGTTGGTCAACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000344161    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_058163.1-439s21c1
Sequence:CCGGTGGAGGTCACAGCTACGAATGCTCGAGCATTCGTAGCTGTGACCTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000344159    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_058163.1-512s21c1
Sequence:CCGGCGCTCAGACTATTAAGGAAGACTCGAGTCTTCCTTAATAGTCTGAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000344162    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_058163.1-154s21c1
Sequence:CCGGAGGATTACTTCATGCGCAATGCTCGAGCATTGCGCATGAAGTAATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000172534    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_058163.1-213s1c1
Sequence:CCGGGAGCTGTTGACCAACGAGTTTCTCGAGAAACTCGTTGGTCAACAGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000168800    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_058163.1-156s1c1
Sequence:CCGGGATTACTTCATGCGCAATGCTCTCGAGAGCATTGCGCATGAAGTAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000172642    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_058163.1-441s1c1
Sequence:CCGGGAGGTCACAGCTACGAATGATCTCGAGATCATTCGTAGCTGTGACCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000168506    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_058163.1-999s1c1
Sequence:CCGGGAGATGAACATGCAAGTGGAACTCGAGTTCCACTTGCATGTTCATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000168306    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_058163.1-153s1c1
Sequence:CCGGGAGGATTACTTCATGCGCAATCTCGAGATTGCGCATGAAGTAATCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000167951    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_058163.1-512s1c1
Sequence:CCGGCGCTCAGACTATTAAGGAAGACTCGAGTCTTCCTTAATAGTCTGAGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000168263    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_058163.1-216s1c1
Sequence:CCGGCTGTTGACCAACGAGTTTGATCTCGAGATCAAACTCGTTGGTCAACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_175146
VALIDATED
TSR2 MISSION shRNA Bacterial Glycerol Stock
TSR2, 20S rRNA accumulation, homolog (S. cerevisiae)
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000276940    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_175146.3-559s21c1
Sequence:CCGGTGGACCATTGTCCGGAGAAAGCTCGAGCTTTCTCCGGACAATGGTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000276999    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_175146.3-926s21c1
Sequence:CCGGTAGGCTGGCTGGATTGGTAATCTCGAGATTACCAATCCAGCCAGCCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000276998    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_175146.3-445s21c1
Sequence:CCGGATGGAGGTGACAGCTACTAATCTCGAGATTAGTAGCTGTCACCTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000276997    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_175146.3-235s21c1
Sequence:CCGGGAGTTTGATACAGTTGTGGAACTCGAGTTCCACAACTGTATCAAACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000285814    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175146.3-519s21c1
Sequence:CCGGCACCCAGACTATTAAGGAAGACTCGAGTCTTCCTTAATAGTCTGGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000184361    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175146.2-512s1c1
Sequence:CCGGGATCCAGACACCCAGACTATTCTCGAGAATAGTCTGGGTGTCTGGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000183087    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175146.2-609s1c1
Sequence:CCGGCCCTCGTTTGTTAAATGTTATCTCGAGATAACATTTAACAAACGAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000179286    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175146.2-236s1c1
Sequence:CCGGGAGTTTGATACAGTTGTGGAACTCGAGTTCCACAACTGTATCAAACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000181186    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175146.2-520s1c1
Sequence:CCGGCACCCAGACTATTAAGGAAGACTCGAGTCTTCCTTAATAGTCTGGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_175146
VALIDATED
TSR2 MISSION shRNA shRNA Plasmid DNA
TSR2, 20S rRNA accumulation, homolog (S. cerevisiae)
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000276940    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_175146.3-559s21c1
Sequence:CCGGTGGACCATTGTCCGGAGAAAGCTCGAGCTTTCTCCGGACAATGGTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000276999    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_175146.3-926s21c1
Sequence:CCGGTAGGCTGGCTGGATTGGTAATCTCGAGATTACCAATCCAGCCAGCCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000276998    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_175146.3-445s21c1
Sequence:CCGGATGGAGGTGACAGCTACTAATCTCGAGATTAGTAGCTGTCACCTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000276997    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_175146.3-235s21c1
Sequence:CCGGGAGTTTGATACAGTTGTGGAACTCGAGTTCCACAACTGTATCAAACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000285814    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175146.3-519s21c1
Sequence:CCGGCACCCAGACTATTAAGGAAGACTCGAGTCTTCCTTAATAGTCTGGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000184361    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175146.2-512s1c1
Sequence:CCGGGATCCAGACACCCAGACTATTCTCGAGAATAGTCTGGGTGTCTGGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000183087    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175146.2-609s1c1
Sequence:CCGGCCCTCGTTTGTTAAATGTTATCTCGAGATAACATTTAACAAACGAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000179286    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175146.2-236s1c1
Sequence:CCGGGAGTTTGATACAGTTGTGGAACTCGAGTTCCACAACTGTATCAAACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000181186    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175146.2-520s1c1
Sequence:CCGGCACCCAGACTATTAAGGAAGACTCGAGTCTTCCTTAATAGTCTGGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_175146
VALIDATED
TSR2 MISSION shRNA Lentiviral Transduction Particles
TSR2, 20S rRNA accumulation, homolog (S. cerevisiae)
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000276940    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_175146.3-559s21c1
Sequence:CCGGTGGACCATTGTCCGGAGAAAGCTCGAGCTTTCTCCGGACAATGGTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000276999    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_175146.3-926s21c1
Sequence:CCGGTAGGCTGGCTGGATTGGTAATCTCGAGATTACCAATCCAGCCAGCCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000276998    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_175146.3-445s21c1
Sequence:CCGGATGGAGGTGACAGCTACTAATCTCGAGATTAGTAGCTGTCACCTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000276997    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_175146.3-235s21c1
Sequence:CCGGGAGTTTGATACAGTTGTGGAACTCGAGTTCCACAACTGTATCAAACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000285814    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175146.3-519s21c1
Sequence:CCGGCACCCAGACTATTAAGGAAGACTCGAGTCTTCCTTAATAGTCTGGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000184361    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175146.2-512s1c1
Sequence:CCGGGATCCAGACACCCAGACTATTCTCGAGAATAGTCTGGGTGTCTGGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000183087    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175146.2-609s1c1
Sequence:CCGGCCCTCGTTTGTTAAATGTTATCTCGAGATAACATTTAACAAACGAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000179286    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175146.2-236s1c1
Sequence:CCGGGAGTTTGATACAGTTGTGGAACTCGAGTTCCACAACTGTATCAAACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000181186    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175146.2-520s1c1
Sequence:CCGGCACCCAGACTATTAAGGAAGACTCGAGTCTTCCTTAATAGTCTGGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks